Introduction

Adrenocorticotropic hormone deficiency (ACTHD) is defined by an insufficient production of ACTH by the pituitary, and then low adrenal cortisol production. Proper diagnosis and management of ACTHD is crucial as it is a life-threatening condition in the neonatal period characterized by hypoglycemia, cholestatic jaundice and seizures¹. Constitutional ACTHD, i.e, ACTHD diagnosed at birth or during the first years of life, can be isolated or associated with other pituitary hormone deficiencies, such as growth hormone (GH) or thyrotropin-stimulating hormone (TSH), then as part of combined pituitary hormone deficiency (CPHD). ACTHD can be due to mutations in genes coding for transcription factors responsible for pituitary ontogenesis, especially the T-box transcription factor TBX19 (also known as TPIT), NFKB2, LHX3, LHX4, PROP1, HESX1, SOX2, SOX3, OTX2 and FGF8.

Mutations of TBX19 account for approximately two-thirds of neonatal-onset complete isolated ACTHD¹. TBX19 is a T-box transcription factor restricted to pituitary pro-opiomelanocortin (POMC)-expressing cells in mice and humans. It is essential for POMC gene transcription and terminal differentiation of POMC-expressing cells². POMC is the precursor of ACTH. Tbx19 -deficient mice have only a few pituitary Pomc-expressing cells, with very low ACTH and undetectable corticosterone levels³. In humans with isolated ACTH deficiency, TBX19 mutations lead to loss-of-function by different mechanisms, such as the K146R (exon 2, c.437 A>G) pathogenic variant located in the T-box region, which results in a loss of DNA-binding ability¹.

Thanks to GENHYPOPIT^4–6, an international network aimed at identifying new genetic etiologies of combined pituitary hormone deficiency, we described the first cases of DAVID (Deficient Anterior pituitary with common Variable Immune Deficiency) syndrome, a rare association of hypopituitarism (mainly ACTHD) and immune deficiency (hypogammaglobulinemia) ⁷. DAVID syndrome is associated with variants in the nuclear factor kappa-B subunit 2 (NFKB2) gene^8,9. In particular, we reported that a pathogenic, heterozygous D865G (exon 23, c.2594 A>G) NFKB2 variant was found in a patient presenting with severe recurrent infections from 2 years of age, who at the age of 5 was diagnosed with ACTHD⁷. Mutations in the C-terminal region of NFKB2 lead to the disruption of both non-canonical and canonical pathways^10–12. Full-length NFKB2 (p100) protein has 2 critical serines, S866 and S870, in the C-terminal domain. Phosphorylation of these sites yields the transcriptionally active NFKB2 (p52) through proteasomal processing of p100 protein. The D865G mutation, located adjacent to the critical S866 phosphorylation site, protects mutant protein from proteasomal degradation, causes defective processing of p100 to p52, and results in reduced translocation of p52 to the nucleus^8,11,12. NFKB2^+/D865G resulted in 50% of normal processing to p52, whereas NFKB2^D865G/D865G exhibited near-absence of p52¹². The nuclear factor kappa B (NFKB) signaling pathway is a known key regulator of the immune system^12–14, which likely explains the immune phenotype of patients with DAVID syndrome, including susceptibility to infections and auto-immune disorders¹⁵. In contrast, the underlying mechanism causing pituitary disorders remains unknown, with two predominating hypotheses: an indirect autoimmune hypophysitis, preferentially affecting corticotroph function, or a primary developmental defect suggested by the expression of NFKB2 in the developing human pituitary¹⁶. However, a developmental role for NFKB2 was not confirmed in the mouse: the Lym1 mouse model carrying a homozygous nonsense variant Y868* presented an apparently normal pituitary development and function⁹.

Over the last years, human induced pluripotent stem cell (hiPSC)-derived organoids have emerged as promising models to study many developmental mechanisms and their perturbation in disease¹⁷. Pioneering work on human embryonic stem cells and later, hiPSC, has established that 3D organoid models can replicate aspects of pituitary development^18–20, and could thus be of major interest in modeling pituitary disorders^18,21,22. In the present study, we applied recent progress in genome editing using CRISPR/Cas9²³ to a refined protocol to derive 3D organoids from hiPSC in order to model ACTHD. We validated the recapitulation of corticotroph cell differentiation in vitro by introducing a TBX19 mutation known to induce isolated human ACTHD and documenting the subsequent deficiencies in corticotroph development. When our model was used to characterize the D865G NFKB2 variant found in patients with DAVID syndrome, it displayed dramatically altered corticotroph differentiation in the absence of immune cells, clearly demonstrating for the first time a direct role of NFKB2 in human pituitary development.

Materials and methods

Culture and maintenance of hiPSC lines

The 10742L healthy individual-derived hiPSC line was used in the study as the WT control (provided by the Cell Reprogramming and Differentiation Facility [MaSC], Marseille Medical Genetics, Marseille, France). Information about this hiPSC line is indicated in Suppl. Table S1. Two “knock-in” mutant lines carrying TBX19^K146R/K146R (thereafter also designated as TBX19 KI) and NFKB2^D865G/D865G (thereafter also abridged as NFKB2 KI) were generated using CRISPR/Cas9 editing from the isogenic control line. All hiPSC lines were cultured on six-well plates (Corning, #3335, New York, USA) coated with Synthemax II-SC Substrate (working concentration at 0.025 mg/mL, Corning, New York, USA) and maintained undifferentiated in a chemically defined growth medium (StemMACs hiPSC-Brew XF human medium; MACS Miltenyi Biotec, Paris, France)²⁴. hiPSC lines were maintained in a humidified incubator under conditions of 37°C, 5% CO₂, with a daily change of medium, and passaged when cells reached 60-80 % confluency using enzyme-free ReleSR according to manufacturer’s recommendations (StemCell Technologies, Canada, #05872).

CRISPR/Cas9 mediated genome editing of hiPSC

CRISPR/Cas9 gene editing was used to create the TBX19^K146R/K146R and the NFKB2^D865G/D865G mutations using the method as previously described²⁵. CRISPR/Cas9 was used to generate two mutant hiPSC lines from 10742L hiPSC:

1. The TBX19^K146R/K146R line, harboring the c.437A>G, p.Lys146Arg TBX19 (NM_005149) pathogenic missense variant¹.

2. The NFKB2^D865G/D865G line, harboring the c.2594A>G, p.Asp865Gly NFKB2 (NM_001322934) pathogenic missense variant.

Preparation of the CRISPR/Cas9 sgRNA plasmid

For each targeted gene, sgRNA plasmid was prepared as previously described²⁶. Briefly, we designed a sgRNA sequence within 20 nucleotides from the target site selected with the open-source CRISPOR tool (http://crispor.tefor.net/)²⁷.

The sgRNA sequence used to generate TBX19^K146R was (5’>3’): AAGCTGACCAACAAGCTCAA (see also Table S2).

The sgRNA sequence used to generate N F K^D865GB 2was (5’>3’): GTGAAGGAAGACAGTGCGTA (see also Table S3).

We used the cAB03 (also known as pX459-pEF1alpha) vector as previously described²⁵. Briefly, pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988, Addgene, Teddington, UK) was modified by the EF1 alpha promoter²⁵. The chosen sgRNA was cloned into the cAB03 open plasmid vector using the method previously described by Arnaud et al²⁵. The final vector expressed the corresponding sgRNA under the control of the U6 promoter, as well as Cas9 under the control of the EF-1alpha promoter, and a puromycin resistance gene.

Single-stranded oligo DNA nucleotides (ssODN) design

We also designed donor sequences to generate TBX19^K146R and NFKB2^D865G missense mutations. A donor sequence is used for homology-directed repair, allowing the introduction (“knock-in”, KI) of single nucleotide variations, with low efficiency. To optimize the efficiency of KI editing, the donor sequences were designed as single-stranded oligo DNA nucleotides (ssODN), carrying the mutation of interest, and also included a silent (or blocking) mutation that mutates the protospacer-adjacent motif (PAM) or disrupts the sgRNA binding region to prevent re-cutting by Cas9 after successful editing^28,29,25,30. The ssODN contained 100 nucleotides with homology arms on each side of the target region. The ssODN sequence was as follows (see also Suppl. Tables S2 –S3) :

For TBX19^K146R (5’-3’):

TGGATGAAAGCTCCCATCTCCTTCAGCAAAGTGAGGCTGACCAACAAGTTAAATGGAGGCGG GCAGGTACGAATGAGGCGGGCAGGCCTGGCCACCCGCT.

For NFKB2^D865G (5’-3’):

TCCCATTCCTGTCCCCATTTACCCCCAGCAGAGGTGAAGGAAGGCAGTGCCTACGGGAGCCAG TCAGTGGAGCAGGAGGCAGAGAAGCTGGGCCCACCCC.

The ssODN were synthesized by Integrated DNA Technologies (Coralville, Iowa, US) at Ultramer™ quality.

Electroporation

hiPSC were transfected with constructed sgRNA/Cas9 vectors by electroporation using the Neon Transfection System 100 µL kit (Invitrogen). A summary of the procedure is described in Suppl. Figure S1.

Clone isolation and screening

On day 3 post-transfection, we used a cleaved amplified polymorphic sequences (CAPS) assay to estimate the efficacy of CRISPR/Cas9 in bulk transfected hiPSC populations to choose the number of colonies to be picked³¹. A restriction enzyme recognition site is inserted in the donor template. CAPS primers and restriction enzymes were determined with the help of AmplifX software (version 2.0.0b3; https://inp.univ-amu.fr/en/amplifx-manage-test-and-design-your-primers-for-pcr). CAPS primers were listed in Suppl. Table S4. The CAPS products were separated and visualized by electrophoresis on a 2% agarose gel and analyzed for densitometry with ImageJ^25,30.

After 10 days, the CAPS assay was also used to screen and identify the possible knock-in (KI) clones. KI clones were screened by CAPS assay and confirmed by Sanger sequencing (Genewiz, Leipzig, Germany). Analyses of Sanger traces were done by Sequencher DNA sequence analysis software (version 5.4.6, Gene Codes Corporation, Ann Arbor, MI USA, http://www.genecodes.com) to align sequences of KI clones with WT sequence to confirm the successful edition. Sanger sequencing primers are described in Suppl. Table S4. KI clones were kept, amplified and then cryopreserved.

In vitro pituitary organoids differentiated from hiPSC

Pituitary organoids were produced at the same time, using the same protocol for WT and edited hiPSC lines. Two batches of differentiation with two hundred organoids for each hiPSC line were generated:

Batch 1: WT organoids versus TBX19 KI organoids

Batch 2: WT organoids versus NFKB2 KI organoids

The differentiation protocol was based on a protocol from Matsumoto et al. with some modification.^20,22. hiPSCs were first dissociated into single cells using Accutase. Ten thousand cells per organoid were plated in 20 µL hanging drop under the lid of a 127.8 x 85.5mm single-well plate (Greiner bio-one) in growth factor-free chemically defined medium (gfCDM) supplemented with 10% (vol/vol) Knockout Serum Replacement (KSR; Thermo Fisher Scientific) and 20 µM Y-27632. The lid was inverted over the bottom chamber (filled with 10 mL of sterile water to avoid the evaporation of droplets) and incubated at 37°C/5% CO₂ for 2 days. Once aggregates formed, organoids were transferred to non-adhesive 100×20mm culture dishes (Corning) containing 10 mL of gfCDM medium supplemented with 10% KSR without Y-27632 and incubated at 37°C and 5% CO₂ until day 6. From days 6 to days 17, the medium was supplemented with 10% KSR, 5 nM recombinant human bone morphogenetic protein 4 (BMP4; Peprotech, # AF-120-05ET, USA) and 2 μM Smoothened agonist (SAG; Sigma-Aldrich/Merck, # SML 1314). Half of the medium was renewed every 2 - 3 days.

From day 18, BMP4 was withdrawn and half of the medium was renewed every 2 - 3 days. At this point, organoids were maintained under high-O₂ conditions (40%) and 5% CO₂ in an MCO-5M incubator (Panasonic). From day 30, gfCDM medium supplemented with 20% knockout serum replacement was used, and all medium was renewed every 2-3 days until at least day 105. Induction into pituitary progenitor cells (defined as LHX3+) and into pituitary hormone-producing cells was evaluated by qRT-PCR (on days 0, 6, 18, 27, 48, 75, 105) and immunofluorescence (on days 48 and 105) (see below).

Validating TBX19 ^K146R targeting and assessing off-target mutations by whole genome sequencing (WGS)

For TBX19^K146R, we used whole genome sequencing (WGS) to assess on-target and off-target mutations, because the edited site is far from the cut site (15 bases). DNA extracted from control and TBX19 KI (5 organoids each) was submitted for WGS to an average depth of 15X (Integragen Genomics platform). PCR-free libraries were prepared with the NEBNext Ultra^TM II DNA Library Prep Kits (New England BioLabs) according to supplier recommendations. Specific double-strand gDNA quantification and a fragmentation (300 ng of input with high-molecular-weight gDNA) sonication method were used to obtain approximately 400 bp fragments. Finally, paired-end adaptor oligonucleotides (xGen TS-LT Adapter Duplexes from Integrated DNA Technologies) were ligated and re-paired. Tailed fragments were purified for direct sequencing without a PCR step. DNA PCR free libraries were sequenced on paired-end 150 bp runs on the NovaSeq6000 (Illumina) apparatus. Image analysis and base calling were performed using Illumina Real Time Analysis (RTA) Pipeline with default parameters. Sequence reads were mapped on the Human Genome Build (GRCh38) using the Burrows-Wheeler Aligner (BWA)³². Variant calling was performed via the GATK Haplotype Caller GVCF tool (GATK 3.8.1, Broad Institute)³³. Mutation enrichment was determined using Fisher’s Exact Test. Variants were annotated with Ensembl’s Variant Effect Predictor, VEP) by Integragen Genomics³⁴. NGS analyses confirmed the presence of on-target mutation and the absence of off-target mutation in the top four predicted off-target sites.

Validating NFKB2 ^D865G targeting, assessing off-target mutations and differential expression analysis by bulk RNA sequencing (RNA-seq)

For NFKB2^D865G, we used bulk RNA sequencing (RNA-seq) for analysis of differential RNA expression, and to assess on-target and off-target mutations, because the target site is close to the cleavage site (6 bases). A total of 500 ng of total RNA was extracted from 10 individual organoids (5 NFKB2 KI and 5 control organoids). RNA-seq libraries were generated using the KAPA mRNA HyperPrep kit (Roche). The quality and profile of the libraries were visualized on a Bioanalyzer using the High Sensitivity DNA assay (Agilent) and quantified on a Qubit using the dsDNA High Sensibility Kit (Thermo Fisher Scientific). Finally, we performed a 2x 76-bp paired-end sequencing on a NextSeq500 (Illumina). After quality control using FastQC (Braham Institute), reads were aligned on the GRCh38 human reference genome using STAR (version 2.7.2b)³⁵. BAM files were ordered and indexed using Samtools³⁶. Read counts on genes were determined using StringTie³⁷. We assessed the presence of desired NFKB2 edits according to the CRISPR sgRNA design by direct visualization of the BAM files and the absence of off-target coding variations by the GATK Haplotype Caller GVCF tool ³³. Genes differentially expressed between conditions were identified using the R package DESeq2 (version 1.34.0)³⁸ and assigned as such with an adjusted P-value < 0.05.

Total RNA isolation and quantitative real-time PCR (qRT-PCR) analysis for assessment of mRNA expression during pituitary organoid development

Organoids were harvested from the culture, placed on ice and then stored at −80°C until RNA extraction. The total RNA was extracted from WT, TBX19 KI and NFKB2 KI organoids using the NucleoSpin RNA Plus XS kit (Macherey-Nagel), and measured on a NanoDrop TM 1000 Spectrophotometer (Thermo Fisher Scientific). Organoid RNAs were extracted on days 0, 6 and 18 from 7 or 8 organoids, or on days 27, 48, 75 and 105 from single organoids (3-8 organoids per group for each time point). cDNA was synthesized from 200 ng total RNA using the mix of M-MLV reverse transcriptase (Invitrogen, UK, #28025013), dNTP 10mM (Invitrogen, #10297018), RNAseOut Inhibitor (Invitrogen, #10777019) and random primers (Invitrogen, UK, #48190011). Quantitative PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories), on Quantstudio^TM 5 Real-time PCR system (Thermo Fisher Scientific) and analysed using QuantStudio™ 5 Design & Analysis Software. The thermal cycling profiles were as follows: initial denaturation at 95°C for 20 seconds, followed by 40 cycles of denaturation at 95°C (3 sec), annealing at 60°C (45 sec) and extension at 72°C (45 sec). All samples were assayed in duplicate. The beta-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-tubulin (TUBB) transcripts expressions were used as three endogenous reference controls. Target gene expressions were normalized relative to the mean of the housekeeping genes using the delta Ct method. For gene expression kinetics, these values were normalized relative to the highest mean values of WT during 105 days using the comparative 2^−ΔΔCt method³⁹. Primer sequences used in the experiments are shown in Suppl. Table S7.

Immunofluorescence labeling experiments

At days 48 and 105, ten of each WT and mutant organoids were fixed using 4% buffered paraformaldehyde in standard phosphate-buffered saline (PBS) for an hour at RT before rinsing in PBS. After overnight incubation in 30% sucrose/PBS (w/v) at 4°C, organoids were embedded in Surgipath medium (Leica) and snap frozen. Organoids were cryosectioned at 16 µm. After blocking with 0.01% Triton X100, 10% normal donkey serum, and 1% fish skin gelatin in PBS with 5 ng/mL 4’,6-diamidino-2-phénylindole (DAPI) for an hour at RT, slides were incubated with primary antibody diluted in antibody solution (PBS, Triton as above, 1% normal donkey serum and 0.1% fish skin gelatin) overnight at 4°C, washed and incubated in a 1/500 dilution of secondary antibody in PBS for 2 hours at RT. The primary antibodies and dilutions used in this study are summarized in Suppl. Table S8. Secondary antibodies were species-specific conjugates to Alexa Fluor 488, 555 or 647 (Thermo Fisher Scientific). Fluorescence images were obtained using LSM 800 confocal microscopy (Zeiss).

3D imaging of pituitary organoids

We used a whole-mount immunostaining and clearing protocol adapted from Belle et al⁴⁰. 4-8 organoids of each genotype (WT, TBX19 KI or NFKB2 KI) were fixed by immersion in 4 % buffered paraformaldehyde (PFA) in PBS overnight at 4°C. All steps were carried out on a slowly rotating (70 rpm) agitator. After washing in PBS, organoids were either stored at 4°C or blocked and permeabilized with 5 mL PBSGT for 2 days at RT (PBSGT: 0.2% fish skin gelatin, 0.5% Triton X100 in PBS, NaN₃ 0.01%). Organoids were incubated with primary antibodies in 3 mL PBSGT (at concentrations used on sections) over 5 days at 37°C to increase penetration. Organoids were then washed 6 times in an excess of PBSGT at RT, before incubation with secondary antibodies in 3ml PBSGT at RT overnight. The wash step was repeated. Organoids were then embedded in 1% low-melting temperature agarose in 1X TAE after it had cooled to about 45°C.

As adapted from the iDISCO+ protocol⁴¹, organoids in agarose blocks were progressively dehydrated from 20%, 40%, 60%, and 80% to 100% methanol for 1h at each graded step. After overnight incubation in two parts dichloromethane (DCM, Sigma-Aldrich) to one part 100% methanol, organoids were immersed in 100% DCM for 30 minutes before changing to 100% dibenzyl ether (DBE; Sigma-Aldrich) for transparization over two hours. Samples were maintained in DBE at RT and protected from light in an amber glass vial. Light-sheet fluorescence microscopy (Miltenyi Biotec UltraMicroscope Blaze™) was used to acquire z-stacks of optical sections of pituitary organoids at 4 µm intervals, in Ethyl cinnamate (Sigma-Aldrich). After 3D reconstruction with Imaris software (version 9.6, Bitplane), the number of corticotrophs in each organoid was defined by counting individualized cell-sized (7 µm) objects positive for ACTH immunoreactivity with the Spots automatic classifier after setting parameters in a region of interest containing positively labeled WT cells, then applied to all organoids. Using the Surfaces tool of the Imaris software, the volume of organoids was determined based on thresholds corresponding to their respective fluorescence intensities.

Statistical analysis

Statistical analyses were performed and visualized with GraphPad Prism 9.5.0 software (GraphPad Software, Inc). Data are expressed as means ± SEM. Comparisons between the two groups (mutant versus WT) were performed by unpaired two-tailed t-tests (non-parametric Mann-Whitney test). n refers to the number of samples for each experiment outlined in the figure legends. p values of < 0.05 (*), < 0.01 (**), and < 0.001 (***) were considered statistically significant differences.

Results

Corticotroph deficiency can be modeled by directed differentiation of TBX19 - mutant hiPSC in 3D culture

To first validate the pituitary organoid model and determine whether the TBX19 mutant can affect corticotrophs differentiation, we generated a TBX19 KI hiPSC line from the control line using CRISPR/Cas9 (Figures 1A-1D; Suppl. Figure S1). One KI clone carrying TBX19^K146R/K146R was obtained after screening 100 clones by CAPS and confirmation by Sanger sequencing (Suppl Figure S2). This mutant clone was then amplified and differentiated into pituitary organoids, in parallel with the control line.

Figure 1:

The ability of the TBX19 KI line to differentiate into the hypothalamo-pituitary structure was compared to the control line (200 organoids for each line) using a 3D organoid culture method, in which pituitary-like and hypothalamus-like structures simultaneously develop (Figures 1E, 2A, Suppl Figure S3A-B). In this method, hiPSC differentiate into hypothalamic progenitors in the central part of the organoids, whereas the outer layer differentiates into oral ectoderm, that will in turn develop into anterior pituitary tissue (Figure 2A, Suppl Figure S3). The expression of several key markers of pituitary development and differentiation was then compared in mutant TBX19 KI organoids over time, matched to control WT organoids using qRT-PCR (d0, d6, d18, d27, d48, d75, d105) and immunofluorescence (d48 and d105) (Figure 2A). Organoids grew in the culture medium with average sizes in their greatest dimension from 0.4 mm on day 6 to 1.9 mm on day 105 (Figure 2B).

Figure 2:

Successful differentiation was validated in WT organoids by qRT-PCR, at early stages by the expression of a set of pituitary transcription factors, including HESX1, PITX1 and LHX3, and at the latest stage of corticotroph cell differentiation by the expression of TBX19 and POMC (Figures 2A, 2C-2H). HESX1 is the first specific marker of pituitary primordium and its expression is important for the early determination of the gland. In WT organoids, HESX1 peaked around day 6 of culture, and was rapidly downregulated from day 18 (Figure 2D). Expression of PITX1 (oral ectoderm marker) and LHX3 (pituitary progenitor marker) increased from day 27, then PITX1 reached a plateau from d48 (Figure 2E) whereas LHX3 peaked at d75 and was then slightly downregulated (Figure 2F). Immunofluorescence confirmed the presence of oral ectoderm cells expressing PITX1 and CDH1 (E-cadherin, Suppl Figure S3C), therefore resembling Rathke’s pouch progenitors. The effective generation of pituitary progenitors was confirmed by the presence of LHX3+ cells in WT organoids on day 48 (Figure 3A, Suppl Figure S3A). These cells were located in the outermost layer of WT organoids, surrounding the hypothalamic progenitor layer that expressed NKX2.1 (Suppl Figure S3B). By day 105, WT organoids contained many differentiated corticotrophs co-expressing TBX19 protein in the nucleus and ACTH in the cytoplasm, as seen in confocal microscopy, a critical feature for the rest of our investigations (n=8, Figure 3B, Suppl Figure S3D). Consistent with these images, qRT-PCR results confirmed the highest levels of TBX19 and POMC expression after at least 75 days of culture in WT organoids (Figures 2G-2H). Taken together, these data showed that pituitary organoids in 3D culture mimic human pituitary ontogenesis, and were characterized in our conditions by the ability to differentiate into pituitary progenitors by day 48 and into corticotroph cells by day 105.

Figure 3:

We then tested whether ACTHD could be modeled by TBX19 -mutant pituitary organoids. To this end, the development of pituitary organoids carrying TBX19 KI was matched to WT organoid development and analyzed using qRT-PCR and immunofluorescence for pituitary ontogenesis markers as described above. Our data showed a significant decrease in the expression of HESX1 at d18 and d27 in the mutant (Figure 2D). Both PITX1 and LHX3 transcript levels were significantly decreased by day 48 and day 75 in mutant organoids (Figure 2E and 2F), with only partial recovery for PITX1 by d105, suggesting an impairment of pituitary progenitor generation. Although TBX19 transcript levels were unchanged until d75 (Figure 2G), we observed a decrease in POMC expression in the TBX19 KI organoids that was significant from day 48 onwards (Figure 2H). TBX19 expression was significantly higher in mutant organoids at d105, but this had no influence on POMC expression, which remained very low. These results confirmed that our organoid model can recapitulate the need for a fully functional TBX19 protein to achieve proper POMC gene transcription during human pituitary development.

Next, we checked several pituitary markers by immunofluorescence (Figures 3A-3D). In line with qRT-PCR results, TBX19 KI organoid immunostaining on day 48 showed that LHX3 protein expression was decreased in TBX19 KI organoids (n= 10 organoids for each group, Figures 3A, 3B). By day 105, we observed that there were significantly fewer corticotroph cells expressing ACTH and TBX19 proteins in TBX19^K146R/K146R organoids (n= 10 organoids for each group, Figures 3C, 3D).

Finally, in order to take into account the possibility of regionalized sampling in the section, we performed quantitative analysis of ACTH by transparizing organoids immunostained for the hormone and imaging them by light-sheet confocal microscopy. 3D reconstruction confirmed that ACTH was nearly absent from TBX19 KI organoids on day 105 compared to control organoids (Figures 4A-4B and Suppl Movies 1-2). We observed that corticotroph cell distribution was not uniform throughout the organoids, but was rather concentrated in one or a few buds. In summary, there was a significant decrease in the number of ACTH+ corticotroph cells with a TBX19 KI genotype on day 105 versus control organoids (Figure 4C).

Figure 4:

Together, this first set of experiments demonstrated that genome editing of hiPSC with a KI homozygous pathogenic variant of TBX19 effectively prevented their differentiation into ACTH-producing corticotrophs.

NFKB2 signaling is vital for corticotroph development

As our organoid model for the study of ACTHD was validated with the TBX19 mutant line, we then used the same approach to investigate the potential role of NFKB2 in human hypothalamic-pituitary development. To do so, we first established a NFKB2 KI mutant hiPSC line using CRISPR/Cas9 (Figure 5) from an isogenic control. The NFKB2^D865G homozygous mutation was chosen because it has been shown to severely affect NFKB2 p52 processing¹². Two homozygous KI clones carrying NFKB2^D865G/D865G were obtained after screening by CAPS and confirmation by Sanger sequencing (Suppl Figure S4). We selected one homozygous missense mutation NFKB2 KI clone (#7) to amplify and generated 200 mutant organoids in parallel with 200 WT organoids in 3D culture.

Figure 5:

Next, we compared the development and differentiation of the NFKB2 KI organoids versus WT organoids during the culture by qRT-PCR and immunofluorescence as described above. The results of qRT-PCR showed no significant difference in the peak expression level of HESX1. However, higher HESX1 expression in mutant organoids from d27 to d75 suggested impaired downregulation of the gene (Figure 6B). Concomitantly, a significantly decreased expression of PITX1 and LHX3 in NFKB2 KI organoids was found from d48 onwards, suggesting reduced differentiation of pituitary progenitors (Figures 6C-6D). Similar to what we observed in TBX19 KI mutants, TBX19 expression was increased in NFKB2 KI organoids at d105 (Figure 6E). However, this had no impact on POMC expression levels, which remained significantly lower in NFKB2 KI organoids (Figure 6F), suggesting a role for NFKB2 in corticotroph terminal differentiation.

Figure 6:

As MRI had revealed pituitary hypoplasia in 43% of patients with DAVID syndrome⁴², we investigated whether mutant organoids might be smaller than WT organoids. Comparing the volume of both types of organoids on day 105, we found no significant difference (p= 0.6, WT n=7, mutant n= 8, Figure 6G). In line with qRT-PCR results, immunostaining showed less expression of LHX3 in NFKB2 KI organoids on day 48 compared to the WT (Figures 7A-7B). NFKB2 (the antibody did not discriminate between p100/p52 isoforms) was robustly expressed in WT LHX3+ pituitary progenitors on day 48 (Figure 7A). Unexpectedly, NFKB2 p100/p52 immunostaining was weaker in NFKB2 KI organoids than in WT organoids (Figures 7A-7B). Immunostaining at d105 in NFKB2 KI organoids showed the presence of many TBX19+ nuclei, in line with the qRT-PCR results, but few of them were surrounded by cytoplasmic ACTH signal (Figures 7C-7D). Quantification after 3D reconstruction of transparent whole organoids showed significantly fewer ACTH+ cells in NFKB2 KI organoids on day 105 compared to WT organoids in both qualitative (Figures 8A-8B and Suppl Videos 3-4) and quantitative (Figure 8C) assessments. In the absence of an immune system, this is strong evidence in support of a direct role for NFKB2 signaling in pituitary differentiation.

Figure 7:

Figure 8:

To further investigate other downstream pathways altered in NFKB2 KI pituitary organoids, we performed whole RNA-seq of five distinct organoids on day 48 from the NFKB2 KI line versus five organoids derived from its corresponding hiPSC control line. As we found that only 60-70% of organoids show signs of pituitary cell differentiation, we chose to perform a preselection of organoids, based on RT-qPCR expression of selected markers (SOX2, HESX1, PITX1, LHX3, TBX19, POU1F1 and POMC) in order to avoid having “empty” HPOs sent for bulk RNAseq. Differential expression (DE) gene analysis identified 2559 significantly upregulated and 2260 significantly downregulated genes at adjusted p value (pAdj) < 0.05. The global results are depicted as a heatmap to show the similarities across organoids of similar genotypes (Figure 9A) and a volcano plot highlights the magnitudes of DE between the two groups (Figure 9B).

Figure 9:

NFKB signaling did not seem to be affected in NFKB2 KI organoids, as most genes involved in that pathway had fold-change values between −0.5 and 0.5 when significant (Suppl Figure S5). Among a list of 144 genes known to have a functional influence on pituitary-hypothalamic development as curated from the published literature, 67 were found to be differentially expressed in NFKB2 KI organoids (pAdj < 0.05) (Figure 9B, and Table 1), of which 39 encode transcription factors (Figure 9C). Expression of these transcription factors was mostly downregulated, with a marked decrease in expression of pituitary progenitor markers such as PITX1 and LHX3. In contrast, the earliest Rathke’s pouch marker, HESX1, showed a 2-fold increased expression in NFKB2 KI organoids, suggesting impaired progression of pituitary progenitors towards more differentiated stages.

Table 1:

During pituitary development, progenitors undergo epithelial to mesenchymal transition (EMT). Data from human fetuses¹⁶ suggest that pituitary stem cells/progenitors are in an hybrid state, as they simultaneously express “stemness” as well as epithelial and mesenchymal-associated genes, and expression of all these gene sets decrease in concert during the course of differentiation. While the overall number of anterior pituitary-type cells in NFKB2 KI organoids was not affected, as confirmed by RT-qPCR of the pan-pituitary cell adhesion marker EPCAM, there was a significant decrease in the expression of stemness markers such as HES1, SOX2 and SOX9 (Table 2, left panel), accompanied by increased expression of stem cell-associated epithelial markers CDH1 and KRT8 (Table 2, middle panel) and decreased expression of stem cell-associated mesenchymal markers CDH2 and VIM. Other mesenchymal markers expressed in both stem cells and differentiating cells (COL1A1 and COL1A2) were upregulated (Table 2, right panel). CLDN6, which is expressed in early pituitary progenitors¹⁶, was upregulated (fold change = 2.3; p<0.0001) whereas CLDN9, widely expressed in the fetal human pituitary¹⁶, was decreased (fold change = 0.34; p<0.0001). Overall, these results suggest that progenitors initiate EMT, but stall during the process. Of note, the expression of ZEB2, SNAI1 and SNAI2, key initiators of EMT through the downregulation of CDH1, is significantly increased (fold changes of 1.37, 3.37, and 5.36, respectively; p< 0.01), suggesting that NFKB2 plays an important role downstream from these effectors.

Table 2:

TBX19 K I a n dNFKB2 KI alter hypothalamic-pituitary organoid development through distinct mechanisms

The transcription factor RAX, which is physiologically expressed in the hypothalamus, also showed a moderate but significant decrease in its expression in NFKB2 KI organoids (Figure 9C and Table, 1) suggesting that the phenotype could at least partially be due to a hypothalamic defect. Indeed, among the growth factors known to mediate the interaction between hypothalamus and oral ectoderm during pituitary development in animal models, BMP4, FGF8 and FGF10 had fold-changes of 4.35, 0.5 and 0.26 in NFKB2 KI organoids respectively, whereas SHH, WNT5A and FGF8 expression levels were not modified (Table 1).

In comparing the results of RT-qPCR to those obtained by RNAseq, we found good correlations (R²=0.7595; p<0.0001) between the NFKB2 KI to WT ratios measured with both techniques on the same samples, except for TBX19 (Suppl Figure S7). As we obtained similar results with 2 sets of TBX19 RT-qPCR primers, targeting different exons, and with at least one primer hybridizing over the junction of two exons, we believe the RNAseq results for this gene to be likely biased, though we have not identified the reason.

Comparing gene expression levels between TBX19 KI and NFKB2 KI organoids of developmentally important transcription and growth factors shows their differences. As mentioned before, HESX1 was downregulated at d48 only in NFKB2 KI organoids, whereas both mutants had decreased levels of PITX1 and LHX3, the latter being more severely impacted in NFKB2 KI organoids (Figure 10A). In these, we confirmed the increase in BMP4 and decrease in FGF8 /FGF10 expression seen in RNAseq. We did not find any significant differences in these transcripts between WT and TBX19 KI organoids (Figure 10B), suggesting that the impaired development of pituitary progenitors in this model has a different mechanism.

Figure 10:

We then explored markers of different stages of corticotroph maturation that were recently identified in human fetal pituitary¹⁶. RNAseq on d48 NFKB2 KI organoids showed increased expression of FST, a gene expressed in immature corticotropes, and concomitant decreased levels of fully mature corticotrope markers AR, NR4A2, PCSK1 and POMC (0.63, 0.4, 0.35 and 0.43-fold changes respectively) (Table 1). RT-qPCR at d48, d75 and d105 showed that TBX19 was upregulated at later stages in both models, suggesting that both TBX19 and p52 are involved in the control of TBX19 expression (Figure 11A). The NR4A2 transcription factor was downregulated at d75 in both mutants, but strongly upregulated in TBX19 KI organoids and downregulated in NFKB2 KI organoids at d105 (Figure 11B). PCSK1 expression, necessary for prohormone processing, also decreased in both mutants, but this phenomenon started earlier in NFKB2 KI organoids (Figure 11C). Finally, we found that POMC expression was as strongly impaired in NFKB2 KI organoids as in TBX19 KI organoids. These results, combined with normal expression levels for NEUROD1, corroborate the hypothesis that TBX19-positive precursors fail to achieve terminal differentiation in NFKB2 KI organoids.

Figure 11:

Interestingly, other lineages also appeared to be affected, both in TBX19 KI and NFKB2 KI organoids. RNA-seq at d48 showed drastic downregulation of PROP1 and POU1F1 transcription factors in NFKB2 mutants. Although we could not accurately measure POU1F1 expression at d48 due to its too low expression, RT-qPCR (Figure 11) showed that PROP1 downregulation was also occurring in TBX19 KI organoids at d48 (Figure 11A, left), and both PROP1 and POU1F1 levels were barely detectable at d75 in the two models (Figure 11A and 11D). This is likely to be the consequence of the impaired generation of pituitary progenitors described above. Nonetheless, other transcription factor markers of POU1F1 -dependent lineages were expressed, as shown by normal expression of NEUROD4 and ZBTB20 in TBX19 KI organoids at d48 (Figure 11B and 11C, left). However, both genes had lower expression levels at 75 compared to WT (Figure 11B and 11C, right). In NFKB2 KI organoids, NEUROD4 was downregulated at both time points (Figure 11B), and ZBTB20 at d48 only (Figure 11C, left), with signs of recovery at d75 (Figure 11C, right) and d105 (data not shown). Again, these results suggest that different mechanisms converge on impaired POU1F1-dependent lineage development.

Finally, the glycoprotein hormone common alpha subunit CGA was strongly upregulated at d48 (Table 1) and d75 (data not shown) in NFKB2 KI organoids. The concomitant increase in GATA2, CYP11A1 and FOLR1 may suggest a redirection of some progenitors towards a gonadotroph/thyrotroph cell fate. However, lack of changes in expression of NR5A1, NEUROD1 and SOX11, and the undetectable transcripts for the specific beta subunits FSHB, LHB and TSHB before d105, do not favour this hypothesis.

A few years ago, ChIP-seq experiments on Hodgkin lymphoma cells⁴³ identified 10,893 DNA-binding regions for NFKB2 p52, within or in the close vicinity of 5,497 genes. About half of p52 recruitments occurred in transcribed regions, with a high percentage within introns, and the other half in intergenic regions close to a transcriptional start site (TSS). Among the 4,819 differentially regulated genes identified in NFKB2 KI organoids at d48, 1,398 of them had p52 binding regions nearby (Figure 12), of which 23 belong to our curated list of pituitary genes of interest. Among them, we found genes crucial for progenitor development (SOX9, PITX1), EMT (CDH1, ZEB2), POU1F1-dependent lineages (PROP1, NEUROD4), and most importantly, the principal genes of corticotroph development and maturation (TBX19, NR4A2, PCSK1, POMC). Thus, these changes in the expression of these genes we observed in NFKB2 KI organoids may be due to a direct effect on transcriptional regulation.

Figure 12:

Altogether, our data identify the NFKB2 signaling pathway as an important factor acting at multiple levels on human pituitary development.

Discussion

After the description of DAVID syndrome as a rare combination of anterior pituitary deficit, mostly ACTHD, with common variable immunodeficiency, we and others found that it is associated with NFKB2 gene mutations affecting specific C-terminal residues of the NFKB2 protein, known to play important roles in immunity and also expressed in the pituitary^7,8,9. As the mouse model harboring a similar alteration of the ortholog gene lacked an endocrine phenotype⁹, we wanted to investigate the mechanism of ACTHD in this syndrome. Currently available in vitro models to study ACTHD and CPHD have strong limits. For instance, studies based on transfections and luciferase-coupled hormone promoters can only give indirect evidence of the effect of a variant of unknown significance as they are based on partly arbitrary amounts of DNA and promoters in an artificial context⁵. Murine models only partially replicate human CPHD, as shown for PROP1 mutations and the occurrence of ACTHD (absent in mice but present in 40% of humans)⁴⁴. In the past decade, the reprogramming of differentiated adult cells into induced pluripotent stem cells and advancements in genome editing technologies using CRISPR/Cas9 systems have broadened possibilities for modeling novel aspects of human disease ex vivo ⁴⁵. Organoid culture has become a powerful tool for modeling otherwise inaccessible congenital human disorders in many organs such as brain²⁵, intestine⁴⁶, kidney⁴⁷, liver⁴⁸, pancreas⁴⁹, ovary⁵⁰, and lung⁵¹. In the present study, we established a human in vitro model of congenital ACTHD using 3D pituitary organoids differentiated from TBX19 KI and NFKB2 KI hiPSC generated by CRISPR/Cas9 genome editing, in order to compare them with their WT equivalents on the same genetic background. After confirming that our model could replicate pituitary development, we then determined whether it could also replicate a disease, namely ACTHD. As the TBX19^K146R homozygous variant led to ACTHD in humans, we designed a human “KI” organoid model derived from TBX19^K146R/K146R hiPSC. In line with the Tbx19^−/− mouse model³, TBX19 KI organoids displayed markedly defective corticotroph differentiation, as compared to WT organoids, thereby validating the methodological approach. Interestingly, in organoids carrying a TBX19^K146R/K146R missense mutation that affects DNA binding, a few corticotrophs were still present, suggesting either a role for TBX19 independent of its DNA binding activity or persistence of residual DNA binding activity with this mutation. This model also raises the possibility for a previously undescribed role of TBX19 during early development and the generation of pituitary progenitors in human. However, as TBX19 mutations have only rarely been associated with other pituitary deficits - especially transient GHD⁵², further investigations will be needed.

Figure 13:

Using this same approach with NFKB2^D865G/D865G human organoids generated by CRISPR/Cas9 genome edited hiPSC, we demonstrated for the first time a role for NFKB2 in pituitary development. Heterozygous mutations in the C-terminal region of NFKB2, such as D865G, were reported in DAVID syndrome, leading to the disruption of both non-canonical and canonical pathways^{8,11–13,53,54}. Even though NFKB2^D865G was identified in a heterozygous state in patients with ACTHD, we decided to use a homozygous model of NFKB2 KI to determine whether NFKB2 was involved in pituitary development and could explain the defect in ACTH production in DAVID syndrome (OMIM#, 615577) ^7,8,55. Indeed, while concomitant common variable immune deficiency (CVID) can be explained by the key roles of NFKB signaling in the immune system, the mechanism of the endocrine deficits caused by NFKB2 mutants was unknown. In mouse models, deletion of Nfkb2 cause abnormal germinal center B-cell formation and differentiation¹⁴. However, the Lym1 mouse model, which carries a truncating variant Y868* in the Nfkb2 orthologue that prevents its cleavage into a transcriptionally active form, had apparently normal corticotroph function and ACTH expression in the pituitary in both heterozygotes and homozygotes⁹, despite reduced fertility and more severe immune abnormalities in mutant NFKB2 homozygotes⁵⁶. Using pituitary organoids differentiated from a NFKB2 KI hiPSC line in comparison with its unmutated control and in the absence of an immune response, we have demonstrated that human corticotroph development is directly disrupted by the missense mutation found in DAVID syndrome. The absence of global alteration of NFKB signaling pathway shows that mutant p100/p52 protein is directly responsible for the observed phenotype.

The precise molecular mechanisms by which NFKB2 mutation impairs corticotroph development remain to be determined. However, our results (summarized in Figure 14) suggest both early effects on the maturation of pituitary progenitors, on epithelial to mesenchymal transition, and late effects on corticotroph differentiation. First, The NFKB2 gene product p52 could be involved in the early steps of pituitary development. RNA-seq data on day 48 of NFKB2 KI organoid development showed increased HESX1 and BMP4 transcription, in favor of a blockade in an undifferentiated state evocative of the Rathke’s pouch epithelial primordium: indeed, down-regulation of HESX1 is necessary for proper pituitary development⁵⁷. This is also suggested by RNA-seq results showing downregulation of PITX1, HES1, LHX3 and FGF10 in mutant organoids, whereas their expression is necessary for progression to a progenitor state^58,59. The shift in the BMP4 /FGF10 balance favors the idea that the impaired differentiation of pituitary progenitors is at least in part of hypothalamic origin. Our results also suggest a disorganized EMT process, and the need for a functional p100/p52 to mediate the action of EMT inducers on CDH1 downregulation. Finally, concordant with the hypothesis of a differentiation blockade, upregulation of epithelial markers such as CDH1 and KRT8 was observed in mutant NFKB2 KI organoids on day 48. In contrast, RNA-seq showed no change in Wnt and Hedgehog signaling pathways in NFKB2 KI organoids.

Figure 14:

The NFKB2 gene product p52 could also be involved in the final steps of corticotroph differentiation. While qRT-PCR showed increased levels of TBX19 mRNA in mutant organoids, this did not lead to the expected increase in POMC mRNA transcripts. Moreover, some NFKB2 mutants had TBX19+ cells without ACTH expression. This suggests that p52 is necessary for POMC synthesis, which NFKB2^D865G may prevent. This could be due to an abnormal DNA binding of the NFKB heterodimer to the POMC promoter^60,61, but as other NFKB binding sites are found in intronic regions, it may also be involved in changes in chromatin structures required for proper transcription. The same possibilities apply to PCSK1, the gene coding for the enzyme necessary for POMC to ACTH conversion, and to other genes involved in corticotroph maturation. Besides, NFKB2^D865G could also block TBX19+ cells in a pre-differentiated state of corticotroph cells expressing FST through its derepression of chromatin remodeling factors such as EZH2⁶².

GH deficiency has been reported in some patients with heterozygous NFKB2 mutations¹⁵. The drastic effect on POU1F1 expression we observed is likely to be the consequence of different phenomena. First, the impaired development of progenitors, and the disruption of PROP1 expression, possibly due to the absence of p52. Second, both FOXO1 and NEUROD4 have p52 binding regions and were differentially expressed. Alongside POU1F1, these two genes have been described as crucial members of a feedforward loop controlling somatotroph function⁶³. The 12-fold increase in CGA expression and increased expression of pre-gonadotropes or mature thyrotropes (GATA2) and mature gonadotropes (GATA2, CYP11A1 and FOLR1) could be an argument in favor of a redirection of pituitary progenitors towards these lineages. However, lack of differential expression of NR5A1 contradicts this hypothesis. A more likely explanation is that CGA repression by TBX19 may directly require p52.

The organoid model described in this article presents several advantages over other approaches. It is a true human model of ACTHD, emphasizing the limits of mouse models, as exemplified by the Lym1 model, which showed that Nfkb2 p100/p52 function was not essential for pituitary development in mice, but did not provide insights for humans. Nfkb2^Lym1/Lym1 mice and our NFKB2 KI model have different but functionally very similar mutations, as they both lead to an abnormal processing of p100 with its accumulation leading to a strong reduction of p52 content. The phenotype of Nfkb2^Lym1/Lym1 being more severe than in mice lacking the complete NFKB2 protein (Nfkb2^−/−), these dominant-negative mutations have been called “super repressors”⁵⁶. In light of our results, it is surprising that no pituitary deficiencies have been observed in Nfkb2^−/− or Nfkb2^Lym1/Lym1. This suggests that in human, NFKB2 plays an important role during pituitary development, therefore constituting a major inter-species difference. Studying p52 binding regions across different species may help understand how this role appeared during evolution.

All patients with DAVID syndrome harbour heterozygous NFKB2 mutations. Whether this reflects embryonic lethality of the mutation at the homozygous state or just the rarity of this genotype is still an unresolved question. However “super repressor” mutations have been shown to disturb both canonical and non-canonical signalling pathways even when heterozygous^10,11. As our results show impaired POU1F1-dependent lineages development in addition to the severe corticotroph deficit, further experiments on organoids derived from NFKB2^WT/D865G hiPSCs should tell if there are differences in the sensitivity of different lineages to the dominant-negative protein. If so, this could give us clues about why DAVID patients suffer from isolated ACTHD in their vast majority rather than CPHD.

Despite some technical limits, CRISPR/Cas9-based genome editing of hiPSC is a powerful approach to elucidate gene function in congenital pituitary deficiency patients, as was shown for the role of hypothalamic OTX2 regulation of pituitary progenitor cells in congenital pituitary hypoplasia²⁰. While the prevalence of pathogenic variants of known genes in primary hypopituitarism is currently estimated at below 10%⁶, exome and whole-genome sequencing regularly identify new genes and variants, for which pathogenicity remains uncertain³⁵. This model could thus become in the following years the gold standard to confirm the involvement of a given gene in pituitary development, or to classify new variants of unknown significance as likely benign or pathogenic. Finally, pituitary organoids derived from human embryonic stem cells have been transplanted subcutaneously into mice with hypopituitarism; grafted cells were able to secrete ACTH and respond to corticotropin-releasing hormone stimulation⁶⁴, paving the way for innovative substitutive treatments in patients with hypopituitarism⁶⁵. Conversely, a limitation of this model is the long duration of the differentiation period (approximately 3 months) and the fact that not all hiPSC clones lead to full differentiation of hypothalamo-pituitary organoids despite similar conditions of culture. For these reasons, we could not include confirmation of our results on an independent clone in the present paper.

In conclusion, we have designed and validated a model replicating human constitutive ACTHD using a combination of CRISPR/Cas9 and directed differentiation of hiPSC into 3D hypothalamic-pituitary organoids. Not only has this proof-of-concept reproduced the known prerequisite for the TBX19 transcription factor in human corticotroph differentiation, but it has also allowed a new classification of a NFKB2 variant of previously unknown clinical significance as pathogenic in pituitary development.

From a clinical viewpoint, this organoid model could provide evidence for the pathogenic role of new candidate genes or variants investigated in patients where none other is available, especially in a rare disease affecting a poorly accessible organ like the pituitary gland. From a physiological viewpoint, modeling corticotroph deficiency using hiPSC allows us to find evidence for a functional role for NFKB2 in human pituitary differentiation.

Future studies investigating the direct role of p52 on transcription and changes in chromatin landscape during pituitary development will be necessary to elucidate its precise mechanism of action, as well as the level of pathogenicity of the NFKB2^D865G mutations in its heterozygous form.

Acknowledgements

This study was supported by the ADEREM (Association pour le Développement de la Recherche Médicale au CHU de Marseille), the AFM-Telethon MoThARD grant to TB, and by Pfizer. TTM received funding from France Excellence Scholarship of the French Embassy in Vietnam, from the French Society of Pediatric Endocrinology and Diabetology (SFEDP) and from the Marseille Rare Disease (MarMaRa) Institute of Aix-Marseille University. The authors wish to thank Frederique Magdinier, Natacha Broucqsault and Claire El Yazidi from the Marseille Medical Genetics (MMG) cell reprogramming & differentiation facility (MaSC); Sébastien Courrier, from the MMG microscopy platform; Valerie Delague, Catherine Aubert, Christel Castro and Camille Humbert from MMG’s Genomics and Bioinformatics (GBiM) platform; Carole Siret and Mathieu Fallet from the Centre d’Immunologie de Marseille-Luminy (CIML); Ivo Vanzetta and Alberto Lombardini from the Institut de Neurosciences de la Timone (INT) microscopy platform, and Laurie Arnaud and Emmanuel Nivet from the Institut de Neurophysiopathologie (INP), all in Marseille, for their expert assistance, advice or reagents.

Declaration of interests

The authors declare no competing interests.