1. Computational and Systems Biology
  2. Neuroscience

Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality

  1. Sunitha Rangaraju
  2. Gregory M Solis
  3. Ryan C Thompson
  4. Rafael L Gomez-Amaro
  5. Leo Kurian
  6. Sandra E Encalada
  7. Alexander B Niculescu III
  8. Daniel R Salomon
  9. Michael Petrascheck  Is a corresponding author
  1. The Scripps Research Institute, United States
  2. University of Cologne, Germany
  3. Indiana University School of Medicine, United States
https://doi.org/10.7554/eLife.08833
Share this article
Cite this article
  1. Sunitha Rangaraju
  2. Gregory M Solis
  3. Ryan C Thompson
  4. Rafael L Gomez-Amaro
  5. Leo Kurian
  6. Sandra E Encalada
  7. Alexander B Niculescu III
  8. Daniel R Salomon
  9. Michael Petrascheck
(2015)
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality
eLife 4:e08833.
https://doi.org/10.7554/eLife.08833
  2. Download BibTeX
  3. Download .RIS
7 figures and 11 tables

Figures

Figure 1 with 1 supplement
Download asset Open asset
Transcriptional drift-variance increases with age.

(a) Schematic of RNA-seq experiment. In cohort #1, water or mianserin was added on day 1 of adulthood and RNA samples were harvested on day 1 (water only), day 3 (d3), day 5 (d5) and day 10 (d10). In cohort #2, animals were treated with water or increasing concentrations of mianserin (2, 10 or 50 µM) on day 1 (d1) and RNA was harvested on day 5 (d5) for RNA-seq. In cohort #3, water or 50 µM mianserin was added on day 1, day 3, and day 5, and RNA was harvested on day 10 (d10) for RNA-seq. (b) Venn diagrams of the number of GOs enriched for genes that decrease expression with mianserin (down, dark blue circle) increase expression with mianserin (up, light blue circle) or are enriched for both (intersection). (c) Venn diagrams of the number of GOs enriched for genes that decrease expression with age (down, gray circle) increase expression with age (up, white circle) or are enriched for both (intersection). (d) Heat map depicting log2 changes in gene expression for oxidative stress genes elicited by increasing concentrations of mianserin (yellow, increased expression; blue, decreased expression) (e) Mianserin decreases expression of redox genes that increase with age and increases expression of genes that decrease with age. (f) Mianserin reverts age-associated changes on the level of GOs. Venn diagrams of the number of GOs enriched for genes that decrease expression with mianserin (down, dark blue circle) and increase with age (up, white circle) or vice versa (down with age, gray circle; up with mianserin, light blue circle). (g) Mianserin reverts age-associated changes on the level of individual genes. Volcano plot shows the negative log10 of P-values as a function of log2 fold changes of 3,367 genes that significantly change expression from day 1 to day 3 in samples of water-treated control animals (black) or samples from age-matched mianserin-treated animals (50 µM, blue). As animals age, gene expression levels change (“drift”) away from levels observed in young adults (yellow line). Mianserin treatment attenuates age-associated gene expression changes preserving expression levels as seen in young adults. (h) Drift-plot shows log fold change (old/young) as a function of age for each gene involved in oxidative phosphorylation (gray lines. KEGG: cel 04142). Superimposed are Tukey-style box-plots to graph the increases in drift-variance across the entire pathway. Gene expression changes are classified into type I, which describes activation or repression of the entire pathway and into type II, which describes changes among genes relative to each other (drift-variances), see red arrows. (i) Drift-plot for lysosomal genes (KEGG: cel 00190). See Figure 1—source data 1–5, Figure 1—figure supplement 1 and Table 1 for additional information on data-sets. Also see Methods section for transcriptional drift calculation in each figure panel.

https://doi.org/10.7554/eLife.08833.003
Figure 1—source data 1

RNA-seq gene expression data.

https://doi.org/10.7554/eLife.08833.004
Figure 1—source data 2

Gene ontologies changing in response to mianserin treatment.

https://doi.org/10.7554/eLife.08833.005
Figure 1—source data 3

Gene ontologies changing in response to age.

https://doi.org/10.7554/eLife.08833.006
Figure 1—source data 4

Differentially expressed genes in response to age.

https://doi.org/10.7554/eLife.08833.007
Figure 1—source data 5

Differentially expressed genes in response to mianserin treatment.

https://doi.org/10.7554/eLife.08833.008
Figure 1—figure supplement 1
Download asset Open asset
This figure relates to Figure 1 in main text.

Expression patterns of GO annotations are disrupted with age. Representative pie charts show a cross-section of 50 out of 249 GO annotations enriched for genes that change in opposing direction as animals age (day 3, 5, and 10). The fraction of genes whose expression increase with age (yellow), the fraction of genes whose expression decrease with age (black), and the fraction of genes that maintain the expression seen in young day 1 adults (white) are shown. GOs are sorted and represented in the figure, starting with GOs that show the least disruption in the upper left, and the GO’s with the most extreme changes in the lower right. As animals’ age progresses from day 3, 5 to 10, more and more genes change expression in opposing directions disrupting the transcriptional stoichiometry observed in young day 1 animals. None of these 50 pie charts, as is, allows any statements on how the functional states of the physiological processes they represent change with age. The GO names and number of genes (n) belonging to each GO are shown.

https://doi.org/10.7554/eLife.08833.009
Figure 2 with 2 supplements
Download asset Open asset
Transcriptional drift-variance is attenuated by two longevity paradigms.

(a) Drift-plots show that mianserin attenuates increasing drift-variance with age. Note that drift-variance in 10-day-old mianserin-treated animals is the same as in untreated 3-day-old control animals (dotted red line). (b) Drift-plots show that increasing concentrations of mianserin cause drift-variance to decrease. Drift-variance was measured on day 5 by RNA-seq. (c) Corresponding to b, lifespan curves show that increasing concentrations of mianserin leads to a dose-dependent increase in survival. (d) Drift-plots show that initiating mianserin treatment at later ages reduces (d3) or abolishes (d5) its effect on transcriptional drift. Drift-variance was measured on day 10 by RNA-seq. (e) Corresponding to d, lifespan curves show initiating mianserin treatment at later ages reduces (d3) or abolishes (d5) its effect on lifespan. (f) Log-fold change of xenobiotic gene expression on day 10 when mianserin was added on day 1 or day 5, compared to control animals treated with water on day 1. Adding mianserin on day 1 or day 5 leads to comparable changes. (g) Drift-plots show daf-2 RNAi attenuates increasing drift-variance with age in a manner dependent on daf-16. Left: vector control, middle: daf-2 RNAi, right: daf-16/daf-2 RNAi. P-values for transcriptional drift plots are calculated by robust Levene’s test, which compare variances and not mean values. ***P<0.001. All error bars show drift-variance. See Figure 2—figure supplement 1–2 for additional information on calculating drift-variance and Table 2. Also, see Methods section for transcriptional drift calculation in each figure panel.

https://doi.org/10.7554/eLife.08833.011
Figure 2—figure supplement 1
Download asset Open asset
This figure relates to Figure 1c, d and Figure 5a,b in main text.

(a) Relationship of (a) fold-changes in gene expression as measured by qRT-PCR to b) RNA-seq counts to (c) transcriptional drift and (d) drift-variance plots. Fold-changes in gene expression in older (day 5) animals by mianserin are mostly caused by mianserin preserving the expression levels seen in young animals, thus leading to small drift-variances for groups of genes. (e) Additional transcriptional drift plots for aging C. elegans based on GEO data-sets GSE21784 and GSE46051. Transcriptional drift increases continuously up until at least day 20 towards the end of the lifespan. (f) Transcriptional drift is observed across the entire transcriptome. Random sub-sampling generating ten sets of ~1,000 genes and plotting their drift-variance shows that transcriptional drift is a phenomenon present across the entire transcriptome and is not driven by small subsets of genes.

https://doi.org/10.7554/eLife.08833.012
Figure 2—figure supplement 2
Download asset Open asset
Egg RNA does not affect drift-variance.

(a) DIC photomicrograph of eggs obtained from FUDR (120 µM final) treated animals. Eggs are terminally arrested around the ventral closure (“bean stage”, 400–500 nuclei) and show a shrunken cell mass. Birefringent gut granules are observed in the middle of the eggs. Images were taken ~48 hr after FUDR treatment. (Scale bar = 20 µm). (b) Number of adult worms that produce eggs 24 hr after FUDR treatment. Of the 298 worms evaluated, all of the animals developed germline with eggs inside. (c) Treatment with FUDR dramatically reduces the RNA content in eggs. Total RNA was extracted from FUDR-treated whole wt (N2) worms, from eggs isolated from FUDR-treated N2 worms after ~28 hr of FUDR treatment and from eggs from non-FUDR-treated N2 worms (the same time point as the RNA-seq young reference),. ***P<0.001, comparison between whole worms and eggs treated with FUDR, unpaired t-test, n=3, Error bars S.E.M; ##P<0.01, comparison between eggs treated with FUDR and no FUDR, unpaired t-test, n=3, Error bars S.E.M. (d) Electrophoresis of RNA extracted from whole worms or eggs isolated from FUDR treated animals. Same number of animals used for each sample. Comparison of equal volumes (10 µl) of total RNA loaded from FUDR-treated whole worms and eggs isolated from FUDR-treated animals, resolved in an agarose gel. (e) Original drift plot from Figure 2a is shown again for comparison. Note that box in the middle of the drift plot, which is a Tukey-plot, represents the interquartile mean, or 50% of the transcriptome that changes less with age. As drift is also observed in the interquartile mean, drift is not driven by extreme outliers, but by the majority of the genes across the entire transcriptome. (f) Drift plot generated from our data-set only including genes that were also detected in the CF512 sterile strain data-set from (Murphy et al., 2003). (g) Drift plot generated after removing 7,292 genes involved in egg-related functions detected from an eggs-only RNA-seq data-set (Osborne Nishimura et al., 2015). (h) DIC photomicrograph of eggs obtained from untreated and FUDR-treated animals carrying the Pgcy-8::GFP reporter for AFD neurons. (i) Fluorescence microscopy images show AFD neurons in eggs derived from untreated adults (left panel, white arrows) but not in eggs obtained from FUDR-treated adults (middle panel), confirming that FUDR treated eggs do not progress past the “bean stage”. FUDR does not inhibit Pgcy-8::GFP expression in adults (right panel). (j) Overlay of h and i. (k) Drift plots using our data-set including only the genes that are highly enriched in AFD, ASE or NSM neurons (Etchberger et al., 2007; Spencer et al., 2014). As FUDR arrests embryonic development before the birth of these neurons, the drift-plots cannot be influenced by RNA derived from eggs. Explanations for Figure 2—figure supplement 2 In the experiments presented in the main manuscript, we used FUDR to sterilize the animals from which we subsequently extracted RNA for RNA-seq. Thus, our samples contained fractions of egg RNA. The following control experiments and analysis show that the fraction of RNA in our samples coming from eggs is small and does not influence the phenomenon of transcriptional drift and its attenuation by mianserin. We first isolated eggs from FUDR-treated and untreated animals. FUDR treatment causes the cell mass inside the eggs to shrink and to terminally arrest at around bean stage (400–500 nuclei) (Figure 2—figure supplement 2a). FUDR-treated animals all contained similar numbers of eggs 24 hr after FUDR treatement (n=298) (Figure 2—figure supplement 2b) Note that many of the reported FUDR side-effects such as a lack of germline are not observed in 96-well liquid culture (Gomez-Amaro et al., 2015). Extracting RNA from whole worms or eggs isolated from whole worms showed that FUDR-treated eggs contained 5 times less RNA compared to untreated eggs. The fraction of RNA originating from the eggs in FUDR-treated worms was roughly ~5% (Figure 2—figure supplement 2c,d). We next asked whether this fraction could in anyway influence the phenomenon of transcriptional drift. The original plots (Figure 2a, or Figure 2—figure supplement 2e) of the entire transcriptome show that drift-variance increases in the interquartile mean (boxes) showing that it is not driven by a set of outlier genes, making it unlikely that the 5% fraction would influence drift-variance (Krzywinski and Altman, 2014). Nevertheless, to test possible interference, we calculated drift plots for various subsets of our data excluding transcrips expressed in eggs. The Murphy data were derived from CF512 (sterile) animals and thus any genes detected do not originate from eggs. We therefore excluded all genes not detected by Murphy et al from our data-set and recalculated drift. The resulting drift plot still shows a dramatic increase in drift-variance and attenuation by mianserin (Figure 2—figure supplement 2f). A potential problem with the approach used in Figure 2—figure supplement 2f is that it only removed eggs/germline genes that are specific for eggs but that it did not remove genes that are present in both eggs and soma. We therefore removed all genes that were identified in C. elegans eggs by RNA-seq from our data-set to plot Figure 2—figure supplement 2g (Osborne Nishimura et al., 2015). Of the 7,700 transcripts identified in eggs, 7,200 were present in our data-set. Note that this approach removes all ubiquitously expressed genes like ribosomal, mitochondrial and similar housekeeping genes that are present in both embryos and soma. Even though this operation removes only 7,200 out of 19,196 individual genes present in the data-set, these 7,200 genes account for 73% of total mRNA counts. Despite this dramatic reduction in overall mRNA transcripts, the drift plot combining the remaining 11, 904 genes (mostly low expressing genes) confirms an increase in drift-variance with age that is suppressed by mianserin (Figure 2—figure supplement 2g). To identify gene-sets that cannot possibly originate from the FUDR-treated eggs we exploited the specific arrest in embryonic development caused by FUDR. The DIC images suggested that FUDR arrests embryonic development before the birth of AFD, ASE and NSM neurons. If so, genes in our data-set that are specifically expressed in these neurons have to originate from the adult somatic tissue. To test that FUDR treatment prevents the birth of these neurons, we imaged eggs of C. elegans carrying a Pgcy-8::GFP transgene (AFD marker) (Figure 2—figure supplement 2h, i, j). Eggs from untreated animals showed a clear expression of the marker while FUDR-treated eggs did not (Figure 2—figure supplement 2i, j (n>100)). FUDR did not repress the expression of the Pgcy-8::GFP transgene in adults, showing that the lack of a Pgcy-8::GFP signal in FUDR-treated eggs is due to an arrest before the neurons are born and not due to inhibition of the reporter expression by FUDR. As AFD neurons are born before ASE and NSM neurons, these results suggested that none of these three neurons are present in FUDR-treated eggs (Sulston et al., 1983). After having established the absence of AFD, ASE and NSM neurons in eggs derived from FUDR treated animals, we then used the published gene-sets that are highly enriched in these three neuron types (AFD, ASE, NSM) to construct drift-plots (Etchberger et al., 2007; Spencer et al., 2014). Even for these highly restricted sets of genes, drift-variance dramatically increased with age and was repressed by mianserin. Taken together, these results show that the RNA contamination from FUDR-treated eggs is minimal and that this residual amount does not influence our results.

https://doi.org/10.7554/eLife.08833.013
Figure 3
Download asset Open asset
Preserving low drift-variances in redox pathways preserves redox capacity into old age.

(a) Model for the occurrence of transcriptional drift with age. Genes belonging to the same pathway appropriately respond to a stimulus but subsequently fail to return to steady-state levels. Repeated stimuli compound this effect leading to increases in transcriptional drift. If multiple genes within a pathway have propensity to drift in one or the other direction drift-variance increases with age. (b) Drift-plots show increases in drift-variance in multiple KEGG or GO annotations associated with redox processes. P-values compare variance, not mean, n: No. of genes in each category. *P<0.05, **P<0.01, ***P<0.001, Levene’s test. Error bars; drift-variance (c) Fold increase in survival of N2 wild-type (wt) mianserin treated vs. untreated animals when challenged with paraquat at different ages. The protective effect of mianserin increases with age. *P<0.05, t-test, Error bars: S.E.M. (d) Fold increase in survival of wt (N2) treated vs. untreated animals when challenged with paraquat on day 10. Delaying mianserin treatment into later life reduces its protective effect. *P<0.05, t-test, Error bars: S.E.M. (e) Linear regression of log fold-changes in gene expression with age for genes previously shown to change upon oxidative stress. Genes upregulated in response to oxidative stress (n=252) increase with age, and genes downregulated in response to oxidative stress decrease (n=88) with age. Mianserin attenuates age-associated expression changes in oxidative stress genes in the direction indicated by blue arrows. Shading: 95% confidence interval. ***P<0.001, Wilcoxon rank-sum test. See Tables 3–5 for detailed statistics and Methods section for transcriptional drift calculation in each figure panel.

https://doi.org/10.7554/eLife.08833.015
Figure 4 with 1 supplement
Download asset Open asset
Preserving redox capacity into old age requires the serotonin receptor SER-5.

(a) Survival of wt (dotted lines) or serotonin receptor mutants and serotonin synthesis mutant (bold lines) treated with water (black) or mianserin (blue) on day 1, followed by increasing concentrations of paraquat on day 5. (b) Bar graph shows fold protection as a ratio of survival of mianserin-treated vs. water-treated GPCR mutant animals ((Mia/water)-1). *P<0.05, **P<0.01, ***P<0.001, n.s., not significant, t-test; Error bars: S.E.M. See Figure 4—figure supplement 1, and Tables 6 and 7 for detailed statistics.

https://doi.org/10.7554/eLife.08833.016
Figure 4—figure supplement 1
Download asset Open asset
This figure relates to Figure 4a in main text.

(a) Survival of wt and two independent alleles of ser-5 mutants, ser-5(tm2647) or ser-5(tm2654), treated with water or mianserin on day 1, followed by increasing concentrations of paraquat on day 5 of adulthood. (b) Hierarchical clustering of fold change [serotonin antagonist/DMSO] in protection of wt (N2) and ser-5 mutant animals, when treated with DMSO or serotonin antagonists on day 1 followed by paraquat on day 5, shows the degree of similarity in protection between 8 structurally different serotonin antagonists (left) and the requirement of ser-5 for these antagonists to protect from oxidative stress. (c) Bar graphs quantifying transcriptional drift by qRT-PCR (log fold-changes in gene expression) in 5-day-old N2 and ser-3(ad1774) animals (left panel), and N2 and ser-4(ok512) animals (right panel) treated with mianserin, relative to water-treated N2, determined by qRT-PCR. Mianserin treatment of ser-3(ad1774) and ser-4(ok512) strains result in a drift pattern, similar to those seen in N2. Thus, these receptors are neither required for drift-attenuation in redox genes, nor for the age-associated increase in oxidative stress resistance (Figure 4). Error bars: S.E.M. For detailed statistics, see Tables 6 and 7.

https://doi.org/10.7554/eLife.08833.017
Figure 5 with 1 supplement
Download asset Open asset
Mianserin attenuates drift-variance in peripheral tissues via SER-5.

(a) Bar graphs quantifying transcriptional drift (log fold-changes in gene expression) as measured by qRT-PCR in 5-day-old N2 and ser-5(ok3087) animals treated with mianserin, relative to water-treated N2. Mianserin treatment increases expression of genes drifting down with age and decreases expression of genes drifting up with age in N2, but not in ser-5(ok3087) mutants. (See 5b). *P<0.05, **P<0.01, ***P<0.001,t-test; Error bars: S.E.M. (b) Log fold-change in gene expression as a function of age for stress response genes shown in a. Blue arrows indicate how mianserin treatment corrects age-associated changes in gene expression toward an expression pattern as seen in young adults. (c) Bar graphs quantifying log fold-changes in gene expression in 1-day-old N2 and ser-5(ok3087) animals treated with paraquat, relative to water-treated N2 animals. N2 and ser-5(ok3087) show an identical response to paraquat. (d) Mianserin treatment on day 1 of adulthood enhances transcription of sod and hsp-16.x genes in response to an 8h paraquat treatment on day 5 in wt (N2) animals compared to water treated controls. In contrast, mianserin treatment of ser-5(ok3087) animals did not enhance transcription of sod and hsp-16.x genes. mRNA levels of genes were evaluated by qRT-PCR and plotted as fold induction (PQ/water) (Y-axis) for each gene. (e) Survival plot of mianserin-treated and untreated N2 and ser-5(ok3087) animals. ***P<0.001, *P<0.05, Mantel–Haenszel version of the log-rank test. f) Percent increase in lifespan as a function of mianserin concentration. Mutations in ser-5 or synaptic components rendered the animals partially or completely resistant to mianserin-induced lifespan extension. See Figure 5—figure supplement 1 for additional data, and Table 8 for detailed statistics.

https://doi.org/10.7554/eLife.08833.018
Figure 5—figure supplement 1
Download asset Open asset
This figure relates to Figure 5e in main text.

(a) Kaplan-Meier graphs for lifespan of wt (dotted line) and synaptic mutant animals treated with water (black) or mianserin (blue). Synaptic transmission is required for mianserin-induced lifespan extension. For detailed statistics, see Table 8. (b) Kaplan-Meier graphs for lifespan of wt (dotted lines), ser-5(ok3087), (solid lines) treated with DMSO or serotonin antagonists namely: Dihydroergotamine, Metergoline, Amperozide, Methiothepin, Ketanserin, Mirtazapine, LY-165,163/PAPP or mianserin, on day 1 of adulthood. All 8 serotonergic antagonists completely or partially depend on ser-5.

https://doi.org/10.7554/eLife.08833.019
Figure 6 with 1 supplement
Download asset Open asset
Mianserin extends lifespan by specifically slowing age-associated changes in early adulthood.

(a) PCA plot of RNA-seq data. Each circle represents one RNA-seq sample with the age, in days, indicated. Mianserin-treated day 10 samples show the same transcriptional age as untreated day 3 animals, dotted red line. (b) Mortality curves (moving average) constructed using Gompertz equation for lifespan experiments from 15 independent experiments of ~100 animals each treated with water or mianserin 50 µM (n>1500 total for each condition). Mianserin treatment causes a 7–8 day parallel shift in log mortality as compared to the water-treated animals. (c) Survival of wt animals treated with mianserin for 8 hr, 1 day, 5 days or throughout life was determined and compared to water treated control animals. Removing mianserin after 8 hr or 1 day lessens its effect on lifespan, while removing mianserin on day 5 or maintaining treatment throughout life showed a comparable effect. (d) Mean survival of wt animals treated with water or mianserin for 8 hr, 1 day, 5, 10, 15 days or throughout life was plotted as a function of mianserin exposure in days. Mianserin treatment for 5 to 10 days was required and sufficient for an optimal lifespan extension. (e) Distinct modes of lifespan extension: Proportional lifespan extension leads to a proportional extension across life whereas period-specific lifespan extension leads to a reduced rate of age-associated degeneration during a specific period only. Mianserin reduces the rate of age-associated changes in early adulthood, thereby postponing mortality levels by 7–8 days causing a ‘period-specific lifespan extension’. (f) Model for how mianserin modulates age-associated mortality in early adulthood. Blocking serotonergic signaling via SER-5 decreases transcriptional drift-variance with age in redox genes, leading to preserved homeostatic capacity in redox function, which subsequently delays age-associated mortality. (g) Mianserin does not affect reproductive longevity. Wt animals were treated with water or mianserin (50 µM) on day 1 followed by counting the number of viable eggs laid by them on day 1, day 2, day 3 and day 4. h) Chymotrypsin-like 26S proteasome activity measured from wt animals treated with water or mianserin (50 µM) on day 1 followed by proteasome activity assay on day 2 (upper panel) or day 5 (lower panel). Mianserin treatment does not lead to an increase in proteasome activity, unlike long lived germline-less animals. Error bars S.E.M. See Figure 6—figure supplement 1 for additional data and detailed statistics.

https://doi.org/10.7554/eLife.08833.020
Figure 6—figure supplement 1
Download asset Open asset
This figure relates to figure 6 in main text.

(a) Mortality curves constructed using Gompertz equation for lifespan experiments of wt (N2) animals from 15 independent experiments of ~100 animals each treated with water or mianserin 50 µM (n>1500 total for each condition). The shift in log mortality as a function of time with mianserin treatment is parallel to the water-treated animals. See table below for aggregate data showing hazard/mortality for water and mianserin treatment. (b) Power of detection for 500, 1000 and 1500 animals in each cohort as used in Figure 6b (α=0.01). Monte-Carlo simulations based on a parametric model derived from our data were used to determine the power of detection. A lifespan extension of 1 day corresponds to a 5% increase in lifespan. (c) Drift-plots show changes in drift-variance in proteasome pathway (KEGG annotation: 03050) associated with 38 genes involved in proteasome activity in animals treated with water or mianserin (50 µM) on day 1 and harvested on day 3, 5 and 10. Attenuation patterns of drift-variance with mianserin treatment corresponds functionally to changes in proteasome activity on day 2 and day 5 (See panel a). Mianserin slightly increases transcriptional drift on day 5 and slightly reduces proteasome activity function. P-values compare variance, not mean, **P<0.01, Levene’s test. Error bars; drift-variance.

https://doi.org/10.7554/eLife.08833.021
Figure 7
Download asset Open asset
Transcriptional drift-variance increases with age in various species.

(a) Transcriptional drift-variance in gene expression from different mouse tissues aged 13 to 130 weeks. Drift-plots show an increase in drift-variance with age in mouse brain, kidney, liver, lung and spleen (b) Drift-variance plotted as a function of age for different organs. To obtain drift-variance values for young animals, a single transcriptome was set aside and used a reference. (c) Drift-plot for gene expression from 32 human brains (frontal cortex) plotted as a function of age in years. Data binned in 20-year increments. (d) Drift-variance plotted as a function of age in years for individuals. Each dot corresponds to one brain sample (frontal cortex). Shading indicates 95% confidence interval (ρ=0.603, P=0.0014). (e) Drift plots show a higher transcriptional drift-variance in BJ fibroblasts (BJ) and fibroblasts from Hutchinson Gilford progeria syndrome (HGPS), when compared to H9 embryonic stem cells. Reprogramming the BJ and HGPS cells to induced pluripotent stem cells (iPSCs) leads to a partial reversal of the transcriptional drift-variance to a lower variance corresponding to the young phenotype of the iPSCs. See Figure 2—figure supplement 1 for additional information on transcriptional drift calculation, and Methods section for transcriptional drift calculation in each figure panel.

https://doi.org/10.7554/eLife.08833.022

Tables

Table 1

GO annotations enriched for genes upregulated by mianserin during all ages, assessed by RNA-seq (day 3, 5 and 10).

https://doi.org/10.7554/eLife.08833.010
GOEnriched P-value
response to stimulus4.47E-08
response to stress5.83E-05
response to xenobiotic stimulus3.25E-07
defense response4.66E-05
innate immune response1.56E-02
immune response1.62E-02
immune system process1.62E-02
aging6.63E-05
multicellular organismal aging6.63E-05
determination of adult lifespan6.63E-05

  1. Note: No process was specifically downregulated for all three ages.

Table 2

Survival data for lifespan of RNA-seq experimental cohorts.

https://doi.org/10.7554/eLife.08833.014
StrainTreatmentTreatment
added on [day]		Conc. [µM]Change in lifespan [%]
Expt.1/ Expt.2/ Expt.3		P-value
Expt.1/ Expt.2/ Expt.3		Mean Lifespan [days]
Expt.1/ Expt.2/ Expt.3		Number of animals
Expt.1/ Expt.2/ Expt.3
N2Waterd1019.33/ 17.2/ 20.45132/ 149/ 130
N2Miad12+7/ +12/ -40.20/ 0.04/ 0.2520.64/ 19.23/ 19.67125/ 133/ 151
N2Miad110+30/ +16/ +62.5E-07/ 3.7E-03/ 0.5525.09/ 19.92/ 21.7494/ 138/ 136
N2Miad150+46/ +39/ +251.1E-19/ 1.9E-15/ 2.8E-0828.25/ 23.92/ 25.6395/ 131/ 125
N2Miad350+15/ +14/ +12.0E-03/ 9.3E-04/ 0.2922.23/ 19.69/ 20.75121/ 134/ 152
N2Miad550-8/ +8/ -20.18/ 0.06/ 0.8417.79/ 18.52/ 20.13123/ 151/ 139

  1. Summary of all lifespan experiments performed in parallel for cohorts 1 and 2 of the RNA-seq studies in Figure 2c,e. The treatments, water or mianserin, at the indicated concentrations (conc.) were added on indicated day (D) of adulthood and lifespan (days) was scored until 95% of animals were dead in all tested conditions. All values (Change in lifespan [%], P-values) were calculated for the pairwise comparison between mianserin-treated and water-treated animals of the same condition, in 3 independent experiments (expts.). Statistical analysis was performed using the Mantel–Haenszel version of the log-rank test. Mean lifespan [days] and number of animals in each experiment are indicated.

Table 3

Gene ontology (GO) pathways of relevance to this study that are differentially regulated by mianserin.

https://doi.org/10.7554/eLife.08833.023
KEGG / GO IDKEGG / GO TermNumber of Genes observedLevene’s test for variance
(Difference in transcriptional drift- variance)
Water D1 vs. water Dx		Levene’s test for variance
(Difference in transcriptional drift- variance)
water Dy vs. mianserin Dy
Transcriptome19,196D3 : P < 1.0E-100
D5 : P < 1.0E-100
D10: P < 1.0E-100		D3 : P < 1.0E-100 D5 : P < 1.0E-100 D10: P < 1.0E-100
KEGG:Cel00030Pentose phosphate pathway17D3 : P = 0.0096
D10: P <1.0E-5		D3 : P <1.0E-4
D10: P = 0.01
GO: 0006979Response to oxidative stress67D3 : P <1.0E-10
D10: P <1.0E-16		D3 : P <1.0E-4
D10: P = 0.001
GO: 0045454Cell redox homeostasis52D3 : P <1.0E-6
D10: P <1.0E-10		D3 : P <1.0E-4
D10: P = 0.029
GO: 006749Glutathione metabolism13D3 : P <1.0E-4
D10: P <1.0E-7		D3 : P =0.041
D10: P <1.0E-4
GO: 0007186G-protein coupled receptor signaling335D3 : P <1.0E-24
D10: P < 1.0E-100		D3 : P <1.0E-4
D10: P <1.0E-4
GO: 0016209Antioxidant activity34D3 : P <1.0E-8
D10: P <1.0E-10		D3 : P = 0.002
D10: P = 0.06

  1. Summary of gene changes with RNA-seq transcriptome analysis in Figure 3b.

  2. GO ID is the Gene Ontology identification number.

  3. GO Term is the Gene Ontology term for the biological process.

  4. Dx = age in days for the animals indicated, compared with D1 water-treated animals.

  5. Dy = age in days for water- and mianserin-treated animals, compared on the same day of age indicated.

Table 4

Survival data for paraquat stress resistance assays.

https://doi.org/10.7554/eLife.08833.024
StrainTreatmentConc.[µM]Treatment added [day]PQ 100 mM, added [day]Survival after PQ [%]
(expt. 1)		Survival after PQ [%]
(expt. 2)		Survival after PQ [%]
(expt. 3)		Mean,
Survival after PQ [%]		 S.D.,
Survival after PQ [%]		P-value No. of wellsTotal no. of animals
N2Water0d1d370.043.162.258.4 13.948450
N2Mia50d1d387.347.953.963.0 21.37.72E-01 48390
N2Water0d1d555.856.266.159.3 5.848436
N2Mia50d1d595.596.192.094.5 2.24.24E-03 48435
N2Water0d1d1063.337.441.747.5 13.948400
N2Mia50d1d1091.982.185.486.4 5.02.85E-02 48390

  1. Summary of all stress resistance assays performed in Figure 3c. The treatments, water or mianserin (Mia), at the indicated concentrations (conc.) were added on day 1 of adulthood. Paraquat (PQ) was added to a final conc. of 100 mM on day 3 (d3), day 5 (d5) or day 10 (d10) and survival after PQ [%] was calculated 24 hr after the respective PQ addition. Mean and standard deviation (S.D.) of survival after PQ [%] were calculated from 3 independent experiments (expts.). P-values were calculated between water and mianserin-treatments on the same day of PQ addition, using unpaired t-test. The total number of wells and animals from which data were collected are indicated.

Table 5

Survival data for paraquat stress resistance assays, mianserin added on different days.

https://doi.org/10.7554/eLife.08833.025
Strain TreatmentConc. [µM]Treatment
added day		PQ 100 mM,
added day		Survival [%]
(expt. 1)		Survival [%]
(expt. 2)		Survival [%]
(expt. 3)		Mean, Survival [%] S.D.,
Survival [%]		P-value No. of wellsTotal no. of animals
N2 Water0d1d1063.3037.4441.7247.48 13.8648400
N2 Mia50d1d1091.8582.0585.3886.43 4.972.85E-02 48390
N2 Water0d3d1063.9741.2538.3547.85 14.0248403
N2 Mia50d3d1078.5266.2273.6272.79 6.190.074 48378
N2 Water0d5d1057.3143.8342.5747.90 8.1648387
N2 Mia50d5d1068.6350.5858.6259.28 9.040.18 48398

  1. Summary of all stress resistance assays performed in Figure 3d. The treatments, water or mianserin (Mia), at the indicated concentrations (conc.) were added on day 1 (D1), day 3 (D3) or day 5 (D5) of adulthood. 100mM Paraquat (PQ) was added on day 10 (D10) and survival [%] was calculated after 24 hr. Mean and standard deviation (S.D) of survival [%] were calculated from 3 independent experiments (expts.). P-value calculated between water and mianserin-treatments using t-test. The total number of wells and animals from which data were collected are indicated.

Table 6

Survival data for paraquat stress resistance assays.

https://doi.org/10.7554/eLife.08833.026
StrainTreatmentConc. [µM]PQ conc. [mM]Survival after PQ [%]
(expt. 1)		Survival after PQ [%]
(expt. 2)		Survival after PQ [%]
(expt. 3)		Survival after PQ [%]
(expt. 4)		Survival after PQ [%]
(expt. 5)		Survival after PQ [%]
(expt. 6)		Mean,
Survival after PQ [%]		S.D.,
Survival after PQ [%]		P-valueNo. of wellsTotal no. of animals
N2Water0089.998.995.898.293.993.295.03.448548
Water01576.4888295.395.591.788.27.748578
Water02574.291.38092.985.180.484.07.248531
Water05066.267.863.881.961.667.868.27.148530
Water07550.161.144.164.642.451.852.48.948545
Water010036.234.435.553.52354.739.612.348503
Mia50010010099.510010099.299.80.31.71E-0248556
Mia501510098.287.610098.810097.44.93.52E-0248523
Mia502596.298.89598.410098.297.81.84.54E-0348529
Mia50509595.994.595.39998.296.31.81.19E-0448536
Mia507598.989.389.492.697.598.194.34.41.29E-0548516
Mia5010097.690.890.769.893.995.689.710.11.95E-0548539
ser-1
(ok345)		Water009271.389.284.211.224228
Water01573.357.981.871.012.124187
Water02571.355.967.865.08.124209
Water05054.846.442.647.96.224213
Water07539.456.350.748.88.624213
Water010024.227.346.632.712.124224
Mia5001001001001000.00.1324215
Mia501598.897.797.698.00.70.0624211
Mia502597.994.298.496.82.31.51E-0224194
Mia505094.895.49795.71.14.52E-0324224
Mia507593.989.992.492.12.09.87E-0324232
Mia5010087.489.689.588.81.21.45E-0224234
ser-2
(pk1357)		Water0010010095.510098.92.332278
Water0158897.573.792.287.910.232239
Water02590.31008383.289.18.032206
Water05076.787.273.762.775.110.132254
Water07573.973.265.25366.39.732220
Water01007259.654.447.758.410.332220
Mia50098.910010010099.70.60.5132231
Mia50151001001001001000.00.1032255
Mia502598.910098.996.998.71.30.1032228
Mia505010010095.596.998.12.31.71E-0232243
Mia507598.99596.891.895.63.06.35E-0332245
Mia501009788.792.395.493.43.73.80E-0332210
ser-3
(ad1774)		Water0010010092.697.54.324176
Water0158988.586.888.11.224174
Water02590.585.485.287.03.024216
Water05081.37472.175.84.924176
Water07570.848.658.959.411.124169
Water010043.746.530.140.18.824140
Mia50098.210095.898.02.10.8824176
Mia501598.910098.499.10.83.25E-0424228
Mia502593.810090.294.75.00.1024173
Mia505098.110093.897.33.24.97E-0324174
Mia507592.49591.893.11.73.20E-0224197
Mia5010093.465.682.880.614.01.92E-0224180
ser-4
(ok512)water		0010087.610098.696.66.032249
Water01510072.691.384.487.111.632262
Water02598.267.972.585.581.013.732224
Water0508867.183.363.575.512.032229
Water0756947.275.861.463.412.332225
Water010056.348.36043.252.07.632204
Mia50010095.910010099.02.10.4932212
Mia501596.997.297.597.797.30.40.2132228
Mia502597.510091.795.596.23.50.1132230
Mia505093.896.896.495.395.61.34.31E-0232261
Mia507510091.588.196.594.05.39.66E-0332227
Mia5010096.986.590.38990.74.43.75E-0432252
ser-5
(ok3087)		Water0098.892.29996.73.924206
Water01591.183.685.586.73.924230
Water02586.271.688.282.09.124222
Water05083.267.575.975.57.924222
Water07568.4647769.86.624216
Water010065.158.262.962.13.524232
Mia50098.693.999.297.22.90.8524248
Mia501596.292.997.495.52.33.90E-0224221
Mia50259578.490.988.18.60.4524184
Mia505089.577.482.983.36.10.2524219
Mia507573.255.772.567.19.90.7224213
Mia501006454.679.466.012.50.6524200
ser-5
(tm2647)		Water0097.297.396.997.10.224248
Water01588.891.287.389.12.024230
Water02594.489.985.890.04.324227
Water05079.584.681.781.92.624228
Water07579.973.560.271.210.024248
Water010051.65944.151.67.524224
Mia50096.799.294.396.72.50.8024233
Mia501596.788.49593.44.40.2324246
Mia502597.288.592.492.74.40.4924187
Mia505083.787.885.485.62.10.1324234
Mia507569.777.373.573.53.80.7424203
Mia5010046.475.170.363.915.40.3024196
ser-5
(tm2654)		Water0081.596.383.487.18.124232
Water01568.886.675.977.19.024223
Water02577.189.169.178.410.124226
Water05055.279.878.471.113.824254
Water07547.542.555.348.46.524209
Water010041.23645.841.04.924215
Mia50083.796.390.490.16.30.6324232
Mia501573.770.382.675.56.40.8224232
Mia502566.973.788.276.310.90.8124184
Mia505054.568.854.659.38.20.2924200
Mia507534.941.966.547.816.60.9524227
Mia5010018.230.640.729.811.30.2224187
ser-6
(tm2146)		Water0098.996.998.610098.61.332230
Water01595.189.696.593.73.632260
Water02597.787.590.384.890.15.632221
Water05095.397.584.878.188.99.132256
Water07584.887.17763.578.110.632265
Water010082.478.177.95372.913.432253
Mia50010093.310096.997.63.20.5732278
Mia501598.896.492.495.93.20.4932230
Mia502597.997.596.491.395.83.00.1432190
Mia505010010088.692.595.35.70.2932252
Mia507592.210088.588.992.45.30.0732242
Mia5010095.691.393.495.794.02.14.92E-0232221
ser-7
(tm1325)		Water0068.173.394.578.614.024200
Water01548.149.632.443.49.524142
Water02545.742.930.939.87.924152
Water0503837.836.537.40.824152
Water07516.420.241.826.113.724160
Water010025.123.231.626.64.424134
Mia50098.898.910099.20.70.1324217
Mia501595.893.897.295.61.79.18E-0324212
Mia502510093.497.496.93.32.25E-0324193
Mia505088.59294.691.73.15.30E-0424179
Mia507591.392.489.491.01.51.37E-0224189
Mia5010096.991.781.690.17.88.94E-0424186
tph-1
(mg280)		Water0097.296.198.297.21.124148
Water02566.967.87670.25.024156
Water0505247.156.952.04.924164
Water07532.234.64838.38.524148
Water010012.26.742.320.419.224169
Mia50094.310096.997.12.90.9624161
Mia502590.458.778.675.916.00.6124159
Mia505064.861.76965.23.72.33E-0224158
Mia507552.928.957.946.615.50.4724143
Mia501008.71.840.617.020.70.8524150

  1. Summary of all stress resistance assays performed in Figure 4a. The treatments, water or mianserin (50 µM), with their indicated concentrations (conc.) were added on day 1 of adulthood. Paraquat (PQ) was added in the concentration range of 0 to 100 mM on day 5 and survival after PQ [%] was calculated 24 hr later. Mean and standard deviation (S.D.) of survival after PQ [%] were calculated from 3 to 6 independent experiments (expts.). P-values were calculated between water and mianserin-treatments at the same PQ conc., using t-test. The total number of wells and animals from which data were collected are indicated.

Table 7

Summary of oxidative stress protection by serotonin antagonists.

https://doi.org/10.7554/eLife.08833.027
Strain name Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.1		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.2		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.3		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.4		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.5		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.6		Fold change in survival after PQ [(Drug/DMSO) -1]
Expt.7		Mean,
Fold change in survival after PQ		 S.D.,
Fold change in survival after PQ		P-value
Dihydroergotamine 88 µM
N2 0.620.700.790.191.751.430.91 0.57
ser-5(ok3087) 0.450.150.100.23 0.193.49E-02
Metergoline 33 µM
N2 0.540.570.680.941.241.670.94 0.44
ser-5(ok3087) -0.05-0.27-0.11-0.12-0.13 0.091.50E-03
Amperozide 13 µM
N2 0.930.740.990.922.490.891.16 0.66
ser-5(ok3087) 0.300.03-0.58-0.09 0.451.63E-02
Methiothepin 10 µM
N2 0.801.080.950.360.772.941.391.19 0.89
ser-5(ok3087) 0.070.100.16-0.010.08 0.081.24E-02
Ketanserin 176 µM
N2 0.630.591.131.380.421.710.98 0.51
ser-5(ok3087) -0.41-0.140.01-0.07-0.15 0.181.91E-03
Mirtazapine 50 µM
N2 0.80.71.10.41.00.81.50.89 0.35
ser-5(ok3087) 0.0-0.1-0.1-0.2-0.11 0.071.92E-04
LY-165,163 33/PAPP µM
N2 0.480.491.000.940.531.400.81 0.37
ser-5(ok3087) -0.030.35-0.07-0.160.02 0.233.19E-03
Mianserin 50 µM
N2 1.101.111.180.533.241.601.46 0.94
ser-5(ok3087) 0.14-0.18-0.26-0.10 0.214.49E-02

  1. Summary of all stress resistance assays performed in Figure 4—figure supplement 1b. The treatments, DMSO or serotonin antagonists, with their indicated concentrations (conc.) were added on day 1 of adulthood. Paraquat (PQ) (100 mM) was added on day 5 and survival after PQ [%] was calculated 24 hr later. Mean and standard deviation (S.D.) of survival after PQ [%] were calculated from 3 to 7 independent experiments (expts.). P-values were calculated between N2 and mutant strains for fold change values with indicated small molecule treatments using t-test.

Table 8

Summary of all lifespan data for mianserin.

https://doi.org/10.7554/eLife.08833.028
Cumulative statistics Statistics of individual expts.
Strain Small molecule No. of expts. Mean lifespan [days]
(+Mia/+water)		 change in lifespan [%] S.E.M. No. of animals (+Mia/+water) Mean lifespan (days)
(+Mia/+water)		 change in lifespan [%] P-value No. of animals (+Mia/+water)
N2 Mia 1226.7/19.8 +35 ± 7642/57726.4/19.8 +341.67E-08 77/59
25.5/21.5 +196.85E-07 113/94
28.1/20.1 +403.71E-14 95/104
30.6/19.0 +643.17E-15 57/50
26.8/21.5 +251.87E-11 149/145
22.6/16.6 +271.61E-23 151/125
snt-1
(md290)		 Mia 320.9/18.2 +15 ± 2236/23123.3/19.9 +171.84E-05 86/90
17.3/15.4 +121.18E-02 79/80
22.1/19.3 +152.4E-03 71/61
unc-26
(e205)		 Mia 325.0/26.7 -7 ± 7135/16527.8/26.9 +30.53 54/68
22.2/26.5 -164.52E-02 14/24
26.5/25.3 +50.52 67/73
ser-5
(ok3087)		 Mia 323.4/22.2 +5 ± 5496/45823.6/20.6 +154.19E-02 152/144
26.4/26.2 +10.85 174/144
20.1/19.8 -10.25 170/170

  1. Summary of all lifespan experiments performed in Figure 5e,f and Figure 5—figure supplement 1a. N2 and mutant strains were treated with 50 µM mianserin (Mia) on day 1 and lifespan [days] was scored until 95% of animals were dead in all tested conditions. Cumulative statistics and statistics of individual experiments are shown. Mean lifespan [days], change in lifespan [%] and S.E.M. for mianserin-treated (+Mia) and water-treated (+water) animals from multiple, independent experiments (expts.) are shown. Change in lifespan [%] and P-values for individual experiments were calculated using the Mantel–Haenszel version of the log-rank test. Number of animals in individual experiments and all experiments combined are shown.

Table 9

List of small molecules and chemicals used in this study with information

https://doi.org/10.7554/eLife.08833.029
Molecule nameCAS numberCatalog numberManufacturer
Mianserin HCl21535-47-70997Tocris
Mirtazapine85650-52-8M3368LKT Laboratories
Dihydroergotamine mesylate6190-39-20475Tocris/R&D systems
LY-165,163/PAPP1814-64-8S009Sigma
Mirtazapine61337-67-5M3368LKT labs
Metergoline17692-51-2M3668Sigma
Ketanserin tartarate83846-83-7S006Sigma
Methiothepin mesylate74611-28-2M149Sigma
Amperozide HCl86725-37-32746Tocris/R&D systems
Paraquat
(Methyl viologen)		1910-42-5AC227320010Acros Organics
FUDR50-91-9F0503Sigma-Aldrich
DMSO67-68-5472301Sigma-Aldrich
Table 10

List of mutant and fluorescent strains outcrossed and used in this study.

https://doi.org/10.7554/eLife.08833.030
Strain nameGenotypeNo.of times outcrossedGene nameTransgeneAlleleParent strain(s)
VV78unc-26 (e205) IV 4unc-26 e205 CB205
VV80snt-1 (md290) II 4snt-1 md290 NM204
MT15434tph-1 (mg280) II 4tph-1 mg280 MT15434
DA1814ser-1 (ok345) X 10ser-1 ok345 DA1814
OH313ser-2 (pk1357) X 4ser-2 pk1357 OH313
DA1774ser-3 (ad1774) I 3ser-3 ad1774 DA1774
AQ866ser-4 (ok512) III 5ser-4 ok512 AQ866
VV130ser-5(ok3087) I 4ser-5 ok3087 RB2277
FX2647ser-5 (tm2647) I 0ser-5 tm2647 FX2647
FX2654ser-5 (tm2654) I 0ser-5 tm2654 FX2654
FX2146ser-6 (tm2146) IV 0ser-6 tm2146 FX2146
DA2100ser-7 (tm1325) X 10ser-7 tm1325 DA2100
Table 11

List of oligos used for qRT-PCR

https://doi.org/10.7554/eLife.08833.031
Gene nameqRT-PCR forward primer (5’-3’)qRT-PCR reverse primer (5’-3’)
sod-1 CGTAGGCGATCTAGGAAATGTGAACAACCATAGATCGGCCAACG
sod-2 TTCAACCGATCACAGGAGTCGCTCCAAATCAGCATAGTCG
sod-3 ATGGACACTATTAAGCGCGAGCCTTGAACCGCAATAGTG
sod-4 ATGTGGAACTATCGGAATTGTGGGTTGAGATTGTGTAACTGGA
sod-5 ATGGAGACTCAACCGATGGGACCACGGAATCTCTTCCT
ctl-1 AATGGATACGGAGCGCATACAACCTTGAGCAGGCTTGAAA
ctl-2 TGATTACCCACTGATCGAGGGCGGATTGTTCAACCTCAG
ctl-3 CAATCTAACGGTCAACGACACCATTGGATGTGGTGAGCAG
prdx-2 CATTCCAGTTCTCGCTGACATGATGAAGAGTCCACGGA
prdx-3 GTTCCGTTCTCTTGGAGCTGCTTGTTGAAATCAGCGAGCA
prdx-6 GGAGAACAATGGCTGATGCATCTGAACATGGCGTTTGC
hsp-16.1 ACCACTATTTCCGTCCAGCTTGACGTTCCATCTGAGCCAT
hsp-16.11 ACCACTATTTCCGTCCAGCTTGACGTTCCATCTGAGCCAT
hsp-16.2 TCGATTGAAGCGCCAAAGAATCTCTTCGACGATTGCCTGT
hsp-16.41 TCTTGGACGAACTCACTGGATCTTGGACGAACTCACTGGA
hsp-16.48 CTCATGCTCCGTTCTCCATTGAGTTGTGATCAGCATTTCTCCA
hsp-16.49 CTCATGCTCCGTTCTCCATTGAGTTGTGATCAGCATTTCTCCA
crn-3 GAATGCACTCATGAACAAAGTCTAATGTTCGACTGATGAACCG
rcq-5 GATGTTAGAGCTGTAATTCACTGGATCTCTTCCAGCTCTTCCG
rpl-6 TTCACCAAGGACACTAGCGGACAGTCTTGGAATGTCCGA

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Sunitha Rangaraju
  2. Gregory M Solis
  3. Ryan C Thompson
  4. Rafael L Gomez-Amaro
  5. Leo Kurian
  6. Sandra E Encalada
  7. Alexander B Niculescu III
  8. Daniel R Salomon
  9. Michael Petrascheck
(2015)
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality
eLife 4:e08833.
https://doi.org/10.7554/eLife.08833