Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
Gene (Homo sapiens) | AOC1 | GenBank | HGNC: 80 | |
Recombinant DNA reagent | pRMCE-hDAO (plasmid) | Gludovacz et al., 2016 | | hDAO-WT expression vector |
Recombinant DNA reagent | pRMCE-hDAO-R568S (plasmid) | This paper | | R568S mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO-R571T (plasmid) | This paper | | R571T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO-K575T (plasmid) | This paper | | K575T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO-R568S/R571T (plasmid) | This paper | | R568S/R571T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO-R568S/K575T (plasmid) | This paper | | R568S/K575T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO-R571T/K575T (plasmid) | This paper | | R571T/K575T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hDAO- K570G/R571Q/K572T (plasmid) | This paper | | K570G/R571Q/K572T mutant of hDAO |
Recombinant DNA reagent | pRMCE-hFcDAO (plasmid) | This paper | | Fusion of human IgG Fc and hDAO |
Recombinant DNA reagent | pRMCE-hFcDAO-R568S/R571T (plasmid) | This paper | | Fusion of human IgG Fc and R568S/R571T mutant of hDAO |
Sequence-based reagent | R568S-FP | This paper | PCR primers | ttcaaaaggaagctgccc |
Sequence-based reagent | R568S-RP | This paper | PCR primers | gctgaaggccgcctggc |
Sequence-based reagent | R571T-FP | This paper | PCR primers | acgaagctgcccaagtacc |
Sequence-based reagent | R571T-RP | This paper | PCR primers | tttgaagcggaaggc |
Sequence-based reagent | K575T-FP | This paper | PCR primers | acgtacctgctctttaccagcc |
Sequence-based reagent | K575T-RP | This paper | PCR primers | gggcagcttccttttga |
Sequence-based reagent | R568S/R571T-FP | This paper | PCR primers | aaaacgaagctgcccaagtacctg |
Sequence-based reagent | R568S/R571T-RP | This paper | PCR primers | gaagctgaaggccgcctgg |
Sequence-based reagent | R571T/K575T-FP | This paper | PCR primers | gcccacgtacctgctctttaccagccc |
Sequence-based reagent | R571T/K575T-RP | This paper | PCR primers | agcttcgttttgaagcggaaggc |
Sequence-based reagent | K570G/R571Q/K572T-FP | This paper | PCR primers | cagacgctgcccaagtacctgct |
Sequence-based reagent | K570G/R571Q/K572T-RP | This paper | PCR primers | tccgaagcggaaggccg |
Peptide, recombinant protein | rhDAO-WT | Gludovacz et al., 2016 | | Recombinant human diamine oxidase, wildtype |
Peptide, recombinant protein | rhDAO-R568S | This paper | | R568S mutant of rhDAO-WT |
Peptide, recombinant protein | rhDAO-K575T | This paper | | K575T mutant of rhDAO-WT |
Peptide, recombinant protein | rhDAO-R568S/R571T | This paper | | R568S/R571T mutant of rhDAO-WT |
Peptide, recombinant protein | rhDAO-R568S/K575T | This paper | | R568S/K575T mutant of rhDAO-WT |
Peptide, recombinant protein | rhDAO- K570G/R571Q/K572T | This paper | | K570G/R571Q/K572T mutant of rhDAO-WT |
Peptide, recombinant protein | rhFcDAO | This paper | | Human IgG Fc-rhDAO fusion protein |
Peptide, recombinant protein | rhFcDAO-R568S/R571T | This paper | | Human IgG Fc-rhDAO-R568S/R571T fusion protein |
Cell line (Cricetulus griseus) | CHO-K1_rhDAO-WT | Gludovacz et al., 2016 | | CHO-K1 stably expressing rhDAO-WT |
Cell line (C. griseus) | CHO-K1_rhDAO-R568S | This paper | | CHO-K1 stably expressing rhDAO-R568S |
Cell line (C. griseus) | CHO-K1_rhDAO-K575T | This paper | | CHO-K1 stably expressing rhDAO-K575T |
Cell line (C. griseus) | CHO-K1_rhDAO-R568S/R571T | This paper | | CHO-K1 stably expressing rhDAO-R568S/R571T |
Cell line (C. griseus) | CHO-K1_rhDAO-R567S/K575T | This paper | | CHO-K1 stably expressing rhDAO- R567S/K575T |
Cell line (C. griseus) | CHO-K1_rhDAO- K570G/R571Q/K572T | This paper | | CHO-K1 stably expressing rhDAO- K570G/R571Q/K572T |
Cell line (C. griseus) | CHO-K1_rhFcDAO | This paper | | CHO-K1 stably expressing rhFcDAO |
Cell line (C. griseus) | CHO-K1_ rhFcDAO-R568S/R571T | This paper | | CHO-K1 stably expressing rhFcDAO-R568S/R571T |
Cell line (C. griseus) | ExpiCHO-S | Thermo Fisher Scientific | Cat#: A29133RRID:CVCL_5J31 | |
Cell line (C. griseus) | CHO-K1 | ATCC | Cat#: CCL-61RRID:CVCL_0214 | |
Cell line (H. sapiens) | SK-Hep1 | Sigma-Aldrich | Cat#: 91091816RRID:CVCL_0525 | |
Cell line (H. sapiens) | HUVEC67 | Evercyte | Cat#: CPT-006-0067 | |
Cell line (H. sapiens) | HUVEC/TERT2 | Evercyte | Cat#: CHT-006-0008RRID:CVCL_9Q53 | |
Cell line (H. sapiens) | HDMVEC/TERT164-B | Evercyte | Cat#: CHT-013-0164-B | |
Cell line (H. sapiens) | HDF76 | Evercyte | Cat#: CPT-008-0076 | |
Cell line (H. sapiens) | PODO/TERT256 | Evercyte | Cat#: CHT-033-0256RRID:CVCL_JL76 | |
Cell line (H. sapiens) | LHCN-M2 | Evercyte | Cat#: CkHT-040-231-2RRID:CVCL_8890 | |
Cell line (H. sapiens) | HepG2 | ATCC | Cat#: HB-8065RRID:CVCL_0027 | |
Cell line (H. sapiens) | HeLa | Ellmeier Lab – Medical University of Vienna | | |
Cell line (H. sapiens) | EVT | Velicky et al., 2018 | | |
Antibody | Anti-ABP1 (rabbit polyclonal) | Sigma-Aldrich | Cat#: SAB1410491-100UG | IF (1:500) |
Antibody | Alexa Fluor 488 anti-rabbit (H + L) (donkey polyclonal) | Jackson Research | Cat#: 711-545-152RRID:AB_2313584 | IF (1:500) |
Antibody | IgG serum fraction (rabbit polyclonal) | Boehm et al., 2017 | | WB (1:1000) |
Antibody | β-actin mAB (AC-15) (mouse monoclonal) | Invitrogen | Cat#: AM4302RRID:AB_2536382 | WB (1:5000) |
Antibody | IRDye 800CW anti-rabbit IgG (H + L) (goat polyclonal) | Li-Cor | Cat#: 926-32211RRID:AB_621843 | WB (1:5000) |
Antibody | IRDye 680RD anti-mouse IgG (H + L) (goat polyclonal) | Li-Cor | Cat#: 925-68070RRID:AB_2651128 | WB (1:5000) |
Chemical compound, drug | Histamine | Sigma-Aldrich | Cat#: 53300 | |
Chemical compound, drug | Heparin | Gilvasan | 1000 IU/mL | |
Chemical compound, drug | Heparin (sodium salt from intestinal mucosa) | Sigma-Aldrich | Cat#: H3149 | |
Chemical compound, drug | Diminazene aceturate | Sigma-Aldrich | Cat#: D7770 | |
Commercial assay or kit | Cisbio HTRF histamine 500 test kit | Biomedica | Cat#: 62HTMDPET | |
Commercial assay or kit | Immunotech histamine ELISA | Beckman Coulter | Cat#: IM2562 | |
Commercial assay or kit | ExpiCHO Expression System Kit | Thermo Fisher Scientific | Cat#: A29133 | |
Software, algorithm | R (version 3.6.3) | R Development Core Team, 2020 | | |
Software, algorithm | Kaluza Flow Cytometry Analysis Software (version 2.1) | Beckman Coulter | | |
Software, algorithm | ImageJ/Fiji | Schneider et al., 2012 | | |
Software, algorithm | Pymol (version 2.0) | The PyMOL Molecular Graphics System, version 2.0 Schrödinger, LLC | | |
Software, algorithm | Chimera | UCSF | | AmberTools GUI incorporated |
Software, algorithm | BIOVIA Discovery Studio 2019 | Dassault Systemes | | Modeller 9.2 GUI incorporated |
Software, algorithm | FoldX 4.0 | Schymkowitz et al., 2005 | | |
Other | DAPI stain | Invitrogen | Cat#: D1306 | (80 ng/mL) |