Endogenous Syngap1 alpha splice forms promote cognitive function and seizure protection
- Graduate School of Chemical and Biological Sciences, The Scripps Research Institute, United States
- Departments of Neuroscience and Molecular Medicine, The Scripps Research Institute, United States
- Department of Anatomy and Neurobiology, The University of California, United States
- Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, United States
- Mork Family Department of Chemical Engineering and Materials Science, University of Southern California, United States
- Bioinformatics and Statistics Core, The Scripps Research Institute, United States
- Molecular Physiology of the Synapse Laboratory, Institut d'Investigació Biomèdica Sant Pau, Spain
- Universitat Autònoma de Barcelona, Spain
- Department of Neuroscience, Johns Hopkins School of Medicine, United States
Figures
Figure 1
Schematic of Syngap1 alternative splicing and summary of isoform expression in three new Syngap1 mutant mouse lines.
(A) Map showing alternative use of exons in N- and C-terminal isoforms. N-terminal variants are constituted via use of different start codons in exon1, 4 or 7. Exon4 is present only in B-SynGAP. C-terminal isoforms originate from use of different splice acceptors in exon 19 and 21. SynGAP-α1 contains a type-1 PDZ ligand (QTRV). Structure/function relationships of α2, β, γ isoforms remain largely unknown. (B) Schematics of SynGAP isoforms and protein domains. α and β isoforms include full Pleckstrin Homology (PH) domain. In C-SynGAP, this domain is truncated. Core regions common to all isoforms include C2, GAP (GTPase Activating Protein), Src Homology 3 (SH3)-binding, and coiled-coil (CC) domains. Multiple phosphorylation sites are present downstream of the GAP domain. (C–E) Schematics describing C-terminal splicing events producing distinct isoforms. (F–I) Summary of Wt and three new Syngap1 mutant mouse lines each with distinct targeted alleles that disrupt the function or expression of SynGAP C-terminal isoforms. Bars represent expression levels of each C-terminal protein isoform relative to each Wt littermate control. Primary data for expression levels can be found in subsequent figures.
Figure 2 with 1 supplement
Design and characterization of Syngap1 IRES-TdTomato knock-in mice.
(A) IRES-TdTomato insertion site in relation to α1 and α2 open-reading frames. (B) Genotype ratios and survival probability following heterozygous breeding. (C) Representative western blots showing expression levels of total SynGAP and individual isoforms. Quantification of forebrain expression levels measured by western blot analysis. Relative intensity of bands normalized to total protein signal. Only α1 signal is significantly changed. ANOVA with Tukey’s multiple comparisons test, F(2, 14) = 24.86, n = 5, p < 0.0001 (D) Quantification of total distance traveled in open field test in adult WT or Td/Td mice. Unpaired t-test t(4)=10.42. Note that very few homozygous Td/Td mouse survived through adulthood. (E) Quantification of total distance traveled in open field test in adult WT or +/Td mice. Unpaired t-test t(18)=9.007 (F) Latency of event onset was measured as the time taken to 1st clonus (seizure onset). Unpaired t-test: t(18)=2.588. (G) Percent freezing in remote contextual fear memory paradigm. Unpaired t-test: t(41)=2.49 (H) Plots demonstrating latency to find platform across days in Morris Water Maze training. Linear mixed model for repeated measures. n = 9–12, +/+ vs + /Td, p = 0.3.
-
Figure 2—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig2-data1-v2.pdf
Figure 2—figure supplement 1
mRNA and protein isoform expression in Syngap1 mouse models.
(A) Representative western blots demonstrating total SynGAP and isoform expression level in forebrain lysates from Syngap1+/+ and Syngap1+/- +/-. Relative intensity of bands normalized to total protein signal. Statistical significance is determined by unpaired t-test. Total: t(4)=5.403, α1: t(4)=9.044, α2: t(4)=4.473, β: t(4)=3.931 (B) Syngap1 exon usage in +/+, +/Td, and Td/Td mice. (C) Representative western blots showing expression levels of total SynGAP and individual isoforms at PND110 from in +/+ and +/Td mice. Unpaired t-test. Total: t(6)=1.784, α1: t(6)=3.351, α2: t(6)=5.678, β: t(6)=4.425.
-
Figure 2—figure supplement 1—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig2-figsupp1-data1-v2.pdf
Figure 3 with 1 supplement
Design and characterization of Syngap1β* knock-in mice.
(A) Alternative use of exon19 in distinct splicing events. Exon19 can be spliced into 2 frames shifted by 13 bp. Use of early splice acceptor (green) results in a frameshift and expresses β isoform. Use of the late splice acceptor (blue) allows expression of all other SynGAP C-terminal variants. To specifically disrupt SynGAP-β, a point mutation (A to C) was introduced to the early splice acceptor (indicated with red arrow). (B) Sequence trace of Syngap1β*/+ mice obtained via crossing F0 founders to wild-type mice. Mutation site exhibits equal levels of A and C signal in sequence trace indicating heterozygosity. (C) Representative western blots showing expression levels of total SynGAP and individual isoforms at PND7. Relative intensity of bands normalized to total protein signal. ANOVA with Tukey’s multiple comparisons test. Total: F(2, 9) = 0.7427, p = 0.5029. α1: F(2, 9) = 2.391, p = 0.147. α2: F(2, 9) = 5.333, p = 0.0297. β: F(2, 9) = 42.53, p < 000.1(D) Quantification of total distance traveled in OFT. +/+ (n = 36), β/β (n = 32); Mann-Whitney U = 346, p = 0.0045. (E) Seizure threshold was measured as the time taken to reach three separate events of 1st clonus (event onset) during the procedure. Unpaired t-test t(66)=4.237. (F) Percent freezing in remote contextual fear memory paradigm. % Freezing: t(66)=0.3153. (G) Plots demonstrating latency to find platform across days in Morris Water Maze training session. Statistical significance was determined by using linear mixed model for repeated measures. Genotype: F(1, 15) = 12.22, p = 0.0033.
-
Figure 3—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig3-data1-v2.pdf
Figure 3—figure supplement 1
Further characterization of Syngap1 Beta mutant mice.
(A) Representative western blots showing expression levels of total SynGAP and individual isoforms at PND60-70.ANOVA with Tukey’s multiple comparisons test. Total: F(2, 15) = 0.3477, p = 0.7119. α1: F(2, 15) = 4.102, p = 0.0379. α2: F(2, 15) = 2.664, p = 0.1023. β: F(2, 6) = 18.22, p = 0.0028. (B) 24 hr probe test in Morris water maze. Unpaired t-test. % Duration in target quadrant: t(15)=0.5093. Latency to platform: t(15)=0.8115. Proximity to platform: t(15)=0.9083 (C) Genotype numbers and ratios derived from heterozygous breeding of β* line (7 litters).
-
Figure 3—figure supplement 1—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig3-figsupp1-data1-v2.pdf
Figure 4 with 1 supplement
Characterization of offspring derived from Syngap1+/- and Syngap1β*/+ cross-breeding.
(A) Breeding scheme for offspring genotypes for Syngap1 +/-and Syngap1+/β* lines. (B) Representative western blots showing expression levels of total SynGAP and individual isoforms at PND7 for all genotypes. (C) Quantification of B. Two-way ANOVA with Tukey’s multiple comparison test. Total: (-) allele F(1, 20) = 146.3, p < 0.0001; β* allele F(1, 20) = 0.3344, p = 0.5696. Allelic Interaction F(1, 20) = 0.03191, p = 0.8600. α1: (-) allele F(1, 20) = 56.01, p < 0.0001; β* allele F(1, 20) = 7.009, p = 0.0155; Allelic Interaction F(1, 20) = 0.02397, p = 0.8785. α2: (-) allele F(1, 20) = 81.79, p < 0.0001; β* allele F(1, 20) = 11.92, p = 0.0025; Allelic Interaction F(1, 20) = 0.0044, p = 0.9479. β: (-) allele F(1, 20) = 9.149, p = 0.0067; β* allele F(1, 20) = 9.676, p = 0.0055; Allelic Interaction F(1, 20) = 0.3027, p = 0.5883. (D) Quantification of total distance traveled in open field test. Two-way ANOVA with Tukey’s multiple comparison test. (-) allele F(1, 86) = 28.85, p < 0.0001; β* allele F(1, 86) = 4.132, p = 0.0452; Allelic Interaction F(1, 86) = 0.2951, p = 0.5884 (E) Latency of event onset was measured as the time taken to 1st clonus (seizure onset). Two-way ANOVA with Tukey’s multiple comparison test. (-) allele F(1, 82) = 91.71, p < 0.0001; β* allele F(1, 82) = 8.967, p = 0.0036; Allelic Interaction F(1, 82) = 0.07333, p = 0.7872 (F) Percent freezing in remote contextual fear memory paradigm. Two-way ANOVA with Tukey’s multiple comparison test. (-) allele F(1, 86) = 69.37, p < 0.0001; β* allele F(1, 86) = 0.1544, p = 0.6953; Allelic Interaction F(1, 86) = 1.392, p = 0.2414.
-
Figure 4—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig4-data1-v2.pdf
Figure 4—figure supplement 1
Representative western blots showing expression levels of total SynGAP and individual isoforms at PND60 for all genotypes.
Two-way ANOVA with Tukey’s multiple comparison test.
Total: (-) allele F(1, 44) = 58.57, p < 0.0001; β* allele F(1, 44) = 0.1181, p = 0.7327. Allelic Interaction F(1, 244) = 0.1839, p = 0.6701. α1: (-) allele F(1, 44) = 35.37, p < 0.0001; β* allele F(1, 44) = 4.932, p = 0.031; Allelic Interaction F(1, 44) = 0.3615, p = 0.5508. α2: (-) allele F(1, 44) = 63.95, p < 0.0001; β* allele F(1, 44) = 18.00, p < 0.0001; Allelic Interaction F(1, 44) = 0.03486, p = 0.8527. β: (-) allele F(1, 20) = 9.149, p = 0.0067; β* allele F(1, 20) = 9.676, p = 0.0055; Allelic Interaction F(1, 20) = 0.3027, p = 0.5883.
-
Figure 4—figure supplement 1—source data 1
Representative blots and total protein profiles.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig4-figsupp1-data1-v2.pdf
Figure 5 with 1 supplement
Validation of SynGAP PDZ binding motif (PBM) mutations and construction of the Syngap1PBM mouse line.
(A) Schematic diagram for exon map and alternative use of Exon21 in Syngap1 gene. Exon21b encodes for α1 isoform. Exon 21 a encodes for α2 isoform. Point mutations indicated in red alter exon 21b coding sequence without influencing exon21a open reading frame. (B) Schematics of SynGAPα1 and PSD95 domain structure and the location of point mutations. (C) Illustrations of constructs expressed in HeLa cells to study PDZ-dependent interaction between SynGAP and PSD95. EGFP-CC constructs are homologous to SynGAPα1 C-terminus. (D) Co-localization of EGFP-CCα1 and PSD95-tRFP in HeLa Cells. Representative images showing subcellular localizations of WT or PDZ-binding mutant (PBM) EGFP-CCα1 and PSD95-tRFP in HeLa cells when expressed individually or together. (E) Quantification of (D). Nuclear localization is calculated as the ratio of EGFP signal colocalized with DAPI vs total EGFP intensity in within an individual cell. ANOVA with Tukey’s multiple comparisons test, F(3, 96) = 531.4. p < 0.0001 (F) Schematics of the targeting strategy. The targeting vector was spanning Exon20 and 21. The vector included point mutations in Exon21, a neomycin resistance selection cassette flanked by Cre recombination sites and diphtheria toxin selection cassette (DTA). (G) Southern blot analysis showing the genomic DNA of the tested heterozygous mice compared to C57BL/6 J wild-type DNA. The AflII digested DNAs were blotted on nylon membrane and hybridized with external 5' probe spanning exon19. (H) PCR based genotyping strategy. Primers flanking leftover LoxP site yields 61 bp product in WT and 120 bp product in mutated allele. (I) Representative western blots showing expression levels of total SynGAP and individual isoforms in forebrain lysates. (J) Quantification of I. Relative intensity of bands normalized to total protein signal. Only α1 signal is significantly changed. ANOVA with Tukey’s multiple comparisons test, F(2, 14) = 24.86, n = 5.
-
Figure 5—source data 1
Representative blots.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig5-data1-v2.pdf
Figure 5—figure supplement 1
Determining impact of proposed PBM coding mutations on SynGAP protein.
(A) Illustrations of constructs expressed in H293T cells to study PDZ-dependent interaction between SynGAP and PSD95. (B) Coimmunoprecipitation of PSD-95 and SynGAPα1 from transfected H293T cells. PSD95-tRFP coprecipitates with SynGAPα1. This Interaction was disrupted by PBM mutations. (C) Illustrations of Flag-tagged SynGAP C-terminal constructs expressed in primary cortical neurons. (D) Subcellular localization of wild-type or PBM mutated Flag-CCα1 in primary forebrain neurons. Note that Flag-CC α1 is heavily enriched in dendritic spines compared to Flag-CC PBM. Height of the image is 5 µm. (E) Quantification of synaptic enrichment of Flag-CC constructs. Enrichment in dendritic spines were calculated as the ratio of Flag signal in spines vs dendrites over ratio of EGFP signal in spines vs dendrites. Unpaired t-test, t(9)=6.982 p < 0.0001. Introduced point mutations impeded the enrichment of Flag-tagged SynGAPα1 C-terminal construct in primary forebrain neurons. (F) Genotype frequencies observed from 15 litters following heterozygous crosses. Expected mendelian ratio is highlighted with gray. (G) Antigen for α1-specific antibody in comparison to PBM mutant C-tail. (H) Reduced antigenicity of α1 antibody against PBM mutant C-terminus. H293T cells were transfected with either wild-type or PDZ-binding mutant form of EGFP-SynGAPα1. Lysates were probed for both Pan-SynGAP (D20C7) and α1-specific (06–800) antibody. Relative reduction in α1 to Pan-SynGAP signal demonstrates ~50% reduction in antigenicity. (I) Quantification of (D) Unpaired t-test. t(6)=19.16, n = 4, p < 0.0001. (J) SynGAP α1 mRNA levels in forebrain transcriptome. Normalized reads of Exon21b (specific to α1) were shown in linear scale. ANOVA F(2,6)=0.3009, n = 3, p = 0.7507. No significant changes were found across genotypes indicating that point mutations do not influence the mRNA expression levels.
-
Figure 5—figure supplement 1—source data 1
Representative blots.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig5-figsupp1-data1-v2.pdf
Figure 6 with 1 supplement
SynGAP synapse localization in Syngap1PBM mouse line.
(A) Western blots showing relative distribution of SynGAP in PSD and Syn/Tx fractions from adult hippocampi. Quantification of western blots probing SynGAP (total, α2, β), Synaptophysin and PSD95. For PSD fractions PSD95 and for Syn/Tx fractions Synaptophysin (Syp) were used as loading control. PSD fractions, Total SynGAP t(22)=3.733, p = 0.0011 n = 12 (3 technical replicates for each sample), SynGAPα2 t(6)=0.6855, p = 0.518, SynGAPβ t(6)=0.6813, p = 0.521. Syn/TX fractions Total SynGAP: t(6)=3.049, p = 0.0226, n = 4. Each sample represents hippocampi pooled from 2 mice. (B) Western blots showing relative enrichment of (i) SynGAP and PSD95 in PSD fractions isolated from DIV18-21 cultures, (ii) phospho and total-ERK1/2 levels in whole cell lysates in steady or inactivated state. Synaptic enrichment of SynGAP in (i) steady-state: Unpaired t-test, t(12)=3.040 p = 0.0103. (ii) inactivated state: Unpaired t-test, t(6)=0.5385 p = 0.6096. Erk1/2 phosphorylation is calculated as ratio of phospho- Erk1/2 to total-Erk1/2 in homogenates. Erk1/2 phosphorylation in (i) steady-state: Unpaired t-test, t(6)=2.961 p = 0.0253. (ii) inactivated state: Unpaired t-test, t(4)=1.144 p = 0.3163(C) Synaptic enrichment of total SynGAP in WT and PBM mutants in steady or inactivated state. Levels of SynGAP relative to PSD95 signal in dendritic spines. Left, bar graphs demonstrate mean enrichment in an individual dendritic segment. Steady-state: t(90)=4.393 p < 0.0001. Inactivated: t(78)=0.6982 p = 0.48. Cumulative distribution of SynGAP to PSD95 ratios in individual synapses. Kolmogorov-Smirnov test, Steady-state: p < 0.0001, Inactivated: p = 0.4869. (D) Surface GluA1 expression in primary forebrain cultures in steady or inactivated state. Quantification of mean surface GluA1 levels coincident with PSD95 puncta. Two-way ANOVA with Tukey’s multiple comparisons test. Interaction: F(1,74)=4.112, p = 0.0462, Genotype: F(1,74)=11.09, p = 0.0014. Treatment: F(1,74)=2.329, p = 0.1313. Each n represents an average of 25–30 spines from a dendritic segment belonging to distinct neurons.
-
Figure 6—source data 1
Representative blots.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig6-data1-v2.pdf
Figure 6—figure supplement 1
Isoform-specific regulation of SynGAP protein within the PSD.
(A) Blots showing distribution of SynGAP in PSD and Syn/Tx fractions upon a normal chemical LTP stimulus (200 μM Glycine, no Mg+2) in +/+ neurons. PSD: t(2)=5.696, p = 0.0295. Syn/Tx: t(2)=7.511, P = 0.0173. n = 2, each n represents samples from separate cultures that are fractionated separately. (B) Blots showing distribution of SynGAP in PSD fractions upon weak chemical LTP (cLTP) stimulus (10 uM Glycine, no Mg+2) in +/+ and PBM/PBM neurons. Each n represents samples from separate cultures that are fractionated separately. Bar graphs represents the level of total-SynGAP/PSD95 ratio relative to the unstimulated baseline (Basal) for each genotype. Total SynGAP, +/+: t(6)=1.257 p = 0.2554, PBM/PBM: t(6)=14.27 p < 0.0001. SynGAPα1, +/+: t(6)=0.8266 P = 0.4401, PBM/PBM: t(6)=16.74 p < 0.0001. SynGAPα2, +/+: t(6)=5.706 p = 0.0013, PBM/PBM: t(6)=7.263 p < 0.0003. SynGAPβ, +/+: t(6)=5.894 p = 0.0011, PBM/PBM: t(6)=10.52 p < 0.0001. Note that α1 isoform is dispersed upon WcLTP stimulus only in PBM/PBM.
-
Figure 6—figure supplement 1—source data 1
Representative blots.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig6-figsupp1-data1-v2.pdf
Figure 7
Characterization of native PSD95 complexes from Syngap1PBM animals.
(A) Volcano plot demonstrating the label-free quantitative mass-spectrometry profile of the logarithmic difference in protein levels in the immunoprecipitated PSD95 complexes derived from DIV21 +/+ and PBM/PBM cultures in inactivated state. Only Gpm6a (shown in black) was significantly altered beyond p > 0.001 cutoff. Blue dots represent proteins with type 1 PDZ-ligands. Green dots represent DLG family proteins. p Values were calculated via t-test for each protein. Samples were derived from individual cultures (4 per genotype) which are immunoprecipitated separately. Log2FC was calculated as ratio of PBM/PBM over +/+. (B) List of proteins that are differentially expressed beyond p > 0.05 cutoff. Note that Iqseq2 and Dlgap3 are PDZ-binding proteins. (C) Mass-spectrometry profile of type-1 PDZ binding motif containing proteins in immunoprecipitated PSD95 complex in +/+ vs PBM/PBM inactivated cultures. (D) Western blots showing relative expression of TARPs and Lrrtm2 in PSD fractions from adult hippocampi in +/+ vs PBM/PBM. (E–G) Quantifications of (D). (E) TARPg8 t(6)=0.6961, P = 0.5124. (F) TARPg2-4 t(6)=0.7924, p = 0.4583 (G) Lrrtm2 t(6)=0.5542, p = 0.5995. Each sample represents hippocampi pooled from 2 mice. (H) Comparison of PSD95 and SynGAP IP complexes as reported by Li et al., 2017 and Wilkinson et al., 2017. Note that PSD95 and SynGAP complexes share diverse range of components involving cytoskeletal and scaffolding proteins.
-
Figure 7—source data 1
Mass Spec raw data.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig7-data1-v2.xlsx
-
Figure 7—source data 2
Representative blots.
- https://cdn.elifesciences.org/articles/75707/elife-75707-fig7-data2-v2.pdf
Figure 8
Plasticity and behavior deficits in the Syngap1PBM mouse line.
(A) Facilitation of burst responses was calculated by expressing the area of the composite fEPSP corresponding to the 2nd theta burst within each train as a fraction of the 1st burst response. No statistically significant difference was found between genotypes (wildtypes are shown in gray and PBM/PBM are in red). (B) Magnitude of long-term potentiation (LTP) following delivery of a single train of five theta bursts. The slope of the fEPSP was normalized to the mean value for a 20 min baseline period; shown are group means and standard errors. (C) Percent fEPSP during and immediately after the LTP induction. Note that homozygous mutants reach to peak potential immediately following TBS. (D) Bar graph shows % potentiation in 1 min after stimulus. t(15)=2.499, p = 0.0245. (E) Bar graph shows % potentiation in 60 min after stimulus. t(15)=3.594, p = 0.0027. (F) LTP to STP ratio of individual slices. Note that the level of LTP is proportional to the degree of acute potentiation (1 min after stimulus). t(15)=0.01818, p = 0.9857. (G) Quantification of total distance traveled in OFT. t(45)=3.427, p = 0.0013. (H) Seizure threshold was measured as the time taken to reach three separate events of 1st clonus (event onset) during the procedure. Unpaired t-test t(25)=3.420 p = 0.0022. (I) Percent freezing in remote contextual fear memory paradigm. % Freezing: t(45)=6.463, p < 0.0001. (J) Plots demonstrating latency to find platform across days in Morris Water Maze training session. Statistical significance was determined by using linear mixed model for repeated measures. n = 14, +/+ vs PBM/PBM, p = 0.027.
Figure 9
Analysis of excitatory synapse function in Syngap1PBM, Syngap1β*, and Syngap1td mouse lines.
(A) Representative mEPSCs traces from L2/3 SSC in +/+ vs PBM/PBM (B) Scatter plots and cumulative histograms showing trend towards increase but no significant difference in Amplitudes of mEPSCs +/+ vs PBM/PBM (C) Scatter plots and cumulative histograms showing significant increase in frequency of mEPSCs +/+ vs PBM/PBM. Unpaired t test: p = 0.0245, n = 8 for each genotype. (D) Representative mEPSCs traces from L2/3 SSC in +/+ vs Td/Td. (E) Scatter plots and cumulative histograms showing significantly increased amplitudes of mEPSCs in +/+ vs Td/Td. Unpaired t test: p = 0.0004, n = 17 cells for +/+, n = 11 cells for Td/Td mice. (F) Scatter plots and cumulative histograms showing significant increase in frequency of mEPSCs in +/+ vs Td/Td. Unpaired t test: p < 0.0001, n = 17 cells for +/+, n = 11 cells for Td/Td mice. (G) Representative mEPSCs traces from L2/3 SSC in +/+ vs β*/β*. (H) Scatter plots and cumulative histograms showing significantly decreased amplitudes of mEPSCs in L2/3 SSC for +/+ vs β*/β*. Unpaired t test: p = 0.0424, n = 11 cells for +/+, n = 13 cells for β*/β*. (I) Scatter plots and cumulative histograms showing significant decrease in frequency of mEPSCs in +/+ vs β*/β*. Unpaired t test: p < 0.0001, n = 11 cells for +/+, n = 13 cells for β*/β*.
Figure 10
Single-cell mRNA expression of Syngap1 in mouse cortex and hippocampus.
Allen Brain Map single cell transcriptomics database was mined and summarize to note expression data for Syngap1 in representative cell types in mouse cortex and hippocampus. Original data can be found using the following URL - https://celltypes.brain-map.org/rnaseq/mouse_ctx-hpf_smart-seq?selectedVisualization=Scatter+Plot&colorByFeature=Gene+Expression&colorByFeatureValue=Syngap1.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Mus musculus) | Mouse primary forebrain neurons | This study | 18–21 days in vitro | |
| Biological sample (Mus musculus) | Cortical and hippocampal tissue | Multiple strains (this study) | Male and female | |
| Strain, strain background (Mus musculus) | IRES-TD | Spicer et al., 2018 | C57BL/6 J background | |
| Strain, strain background (Mus musculus) | Beta KO (β*) | This study | C57BL/6 J background | |
| Strain, strain background (Mus musculus) | PBM | This study | C57BL/6 J background | |
| Cell line (Homo sapiens) | HeLa | Farzan Lab (Scripps Research) | ||
| Cell line (Homo sapiens) | H293T | Kissil Lab (Scripps Research) | ||
| Genetic reagent (Rattus norvegicus) | PSD95-tRFP | Addgene | #52,671 | Plasmid |
| Genetic reagent (Mus musculus) | EGFP-CCα1 | This study | Plasmid | |
| Genetic reagent (Mus musculus) | EGFP-CCPBM | This study | Plasmid | |
| Genetic reagent (Mus musculus) | EGFP-SynGAPα1 | This study | Plasmid | |
| Genetic reagent (Mus musculus) | EGFP-SynGAPα1PBM | This study | Plasmid | |
| Antibody | Rabbit polyclonal antibody | Thermo | PA1-046 | Anti-total SynGAP(1:1000) |
| Antibody | Rabbit polyclonal antibody | Millipore | 06–900 | Anti-SynGAPα1(1:1000) |
| Antibody | Rabbit monoclonal antibody | Abcam | ab77235 | Anti-SynGAPα2(1:1000) |
| Antibody | Rabbit polyclonal antibody | Araki et al., 2020 Huganir Lab (JHU) | Anti-SynGAPβ (1:1000) | |
| Antibody | Mouse monoclonal antibody | Thermo | MA1-045 | Anti-PSD95(1:2000) |
| Antibody | Rabbit polyclonal antibody | Novus | NB300-653 | Anti-Synaptophysin(1:1000) |
| Antibody | Mouse monoclonal antibody | CST | 9,106 | Anti-phosphoERK(1:1000) |
| Antibody | Mouse monoclonal antibody | CST | 4,696 | Anti-ERK(1:1000) |
| Antibody | Mouse monoclonal antibody | Millipore | MAB2263 | Anti-GluA1 N-term.(1:500) |
| Antibody | Rabbit polyclonal antibody | Millipore | Ab9876 | Anti-TARP(1:500) |
| Antibody | Rabbit polyclonal antibody | Thermo Pierce | PA521097 | Anti-LRRTM2(1:1000) |
| Sequence-based reagent | IRES-TD Genotyping Primer Fw | IDT | AGATCCACCAGGCCCTGAA | |
| Sequence-based reagent | IRES-TD Genotyping Primer Rev | IDT | GTCTTGAACTCCACCAGGTAGTG | |
| Sequence-based reagent | PBM Genotyping Primer Fw | IDT | CTGGTTCAAAGGCTCCTGGTA | |
| Sequence-based reagent | PBM Genotyping Primer Rev | IDT | CTGTTTGTTTCTCACCTCCAGGAA | |
| Other | CamKII.Cre | Addgene | 105558-AAV9 | Adeno-associated virus (AAV) |
| Other | CAG.Flex.EGFP | Addgene | 28304-PHPeB | Adeno-associated virus (AAV) |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Pierce | 23,225 | |
| Chemical compound, drug | D-AP5 | Tocris | 0106 | |
| Chemical compound, drug | Bicuculline | Tocris | 0109 | |
| Chemical compound, drug | Tetrodotoxin | Tocris | 1,069 | |
| Chemical compound, drug | Glycine | Tocris | 0219 | |
| Chemical compound, drug | Strychnine | Sigma | S7001-25G | |
| Software, algorithm | Prism 8 | Graphpad | ||
| Software, algorithm | ImageJ(Fiji) | NIH |
Additional files
-
Supplementary file 1
Summary of Phenotypes in Syngap1 Isoform Mice: Summary of electrophysiological, behavioral, and protein expression data for the three new Syngap1 mouse lines presented in this study.
- https://cdn.elifesciences.org/articles/75707/elife-75707-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/75707/elife-75707-transrepform1-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Endogenous Syngap1 alpha splice forms promote cognitive function and seizure protection
eLife 11:e75707.
https://doi.org/10.7554/eLife.75707
