Antibody | anti SoxN (Rabbit polyclonal) | Claude Desplan | N/A | IF 1:250 |
Antibody | anti- Ey (Rabbit polyclonal) | Claude Desplan | N/A | IF 1:500 |
Antibody | anti-Slp1 (Rabbit polyclonal) | Claude Desplan | N/A | IF 1:500 |
Antibody | anti-Slp2 (Guinea-pig polyclonal) | Claude Desplan | N/A | IF 1:500 |
Antibody | anti-Scro (Guinea-pig polyclonal) | Claude Desplan | N/A | IF 1:100 |
Antibody | Anti-D (Rabbit polyclonal) | Claude Desplan | N/A | IF 1:500 |
Antibody | Anti-Dpn (Guinea pig polyclonal) | Chris Doe | N/A | IF 1:500 |
Antibody | Anti-Dpn (Rat monoclonal) | Abcam | Antibody#: Ab195173 | IF 1:500 |
Antibody | Anti-B-H1 (Rat polyclonal) | Tiffany Cook | N/A | IF 1:200; Tiffany Cook |
Antibody | Anti-GFP (Sheep polyclonal) | AbD Serotec | 4745–1051 | IF 1:500 |
Antibody | Anti-Repo (mouse monoclonal) | Developmental Studies Hybridoma Bank | 8D12 anti-Repo | IF 1:50 |
Antibody | Anti-PCNA (mouse monoclonal) | Abcam | ab29 | IF 1:10 |
Antibody | Anti-betaGalactosidase (Chicken polyclonal) | Abcam | Antibody#: Ab9361 | IF 1:500 |
Antibody | Cy5 AffiniPure Anti-RatIgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 712-175-153 | IF!:500 |
Antibody | Cy3 AffiniPure Anti-RatIgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 712-165-153 | IF 1:500 |
Antibody | Cy3 AffiniPure Anti-Guinea Pig IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 706-165-148 | IF 1:500 |
Antibody | Alexa Fluor 647 AffiniPure Anti-Guinea Pig (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 706-605-148 | IF 1:500 |
Antibody | Alexa Fluor 488 AffiniPure Anti-Guinea Pig IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 706-545-148 | IF 1:500 |
Antibody | Alexa Fluor 647 AffiniPure Anti-Goat IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 705-605-147 | IF 1:500 |
Antibody | DyLight 405 AffiniPure Anti-Mouse IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 715-475-151 | IF 1:500 |
Antibody | Alexa Fluor 647 AffiniPure Anti-Rabbit IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 711-605-152 | IF 1:500 |
Antibody | Cy5 AffiniPure Anti-Mouse IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 715-175-151 | IF 1:500 |
Antibody | Alexa Fluor 647 AffiniPure Anti-Chicken IgY (IgG) (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 703-605-155 | IF 1:500 |
Antibody | Alexa Fluor 488 AffiniPureDonkey Anti-Mouse IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 715-545-151 | IF 1:500 |
Antibody | Alexa Fluor 488 AffiniPure Anti-Sheep (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 713-545-147 | IF 1:500 |
Antibody | DyLight 405 AffiniPure Anti-Rat IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 712-475-153 | IF 1:500 |
Antibody | DyLight 405 AffiniPure Anti-Rabbit IgG (Donkey polyclonal) | Jackson ImmunoResearch Laboratories Inc | Catalog_#: 711-475-152 | IF 1:500 |
Antibody | anti-Rabbit IgG, Alexa Fluor  555 conjugate (Donkey polyclonal) | Life Technologies | Catalog_#: A-31572 | IF 1:500 |
Antibody | Anti-Opa (Rabbit polyclonal) | J. Peter Gergen | N/A | IF 1:100; J. Peter Gergen |
Antibody | Anti-Erm (Rat polyclonal) | Claude Desplan | N/A | 1:100 |
Recombinant DNA Reagent | pJR12 plasmid | Rister et al., 2015 PMID:26785491 DOI: 10.1126/science.aab3417 | N/A | Jens Rister |
Recombinant DNA Reagent | pCFD5 plasmid | Addgene | Addgene Plasmid #73,914 | Fillip Port |
Recombinant DNA Reagent | UAS-LT3-Dam plasmid | Andrea Brand | N/A | |
Recombinant DNA Reagent | pJR12-hsNICD plasmid | This paper | N/A | See section on ’Plasmid constructs’ in ‘Materials and methods’ |
Recombinant DNA Reagent | UAS-LT3-DamEy | This paper | N/A | See section on ’Plasmid constructs’ in ‘Materials and methods’ |
Recombinant DNA Reagent | UAS-LT3-DamSu(H) | This paper | N/A | See section on ’Plasmid constructs’ in ‘Materials and methods’ |
Recombinant DNA Reagent | CoinFlp plasmid | Addgene | Addgene Plasmid #52,889 | Iswar Hariharan |
Recombinant DNA Reagent | GMR35H02 BAC | BACPAC resources | CH321-94O18 | |
Recombinant DNA Reagent | Su(H) cDNA. | Drosophila Genomicsa Resource Center | GH10914 | |
Recombinant DNA Reagent | Notch cDNA | Drosophila Genomics Resource Center | LD34134 | |
Recombinant DNA Reagent | CH321-86A18 (BAC) | BACPAC resources | | BAC encoding dpn enhancer |
Sequence-based reagent | 220-Ey-1d gBlock | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 220-Ey-2m gBlock | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 220-SuH-1–4 m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 220-SuH-1m4m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 220-Scro-1m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 220-Slp1-1m2m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 850-Ey-1m2d3d | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 850-SuH-1m2m3m6m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 850-SuH-1–6 m | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 850-Scro-1-7d | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | 850-Slp1-1d | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | Ey gene block | This study | N/A | See Supplementary file 4 for sequence |
Sequence-based reagent | SlpR2-2FP | This study | N/A | 5’TTAGGCGCGCCAGTGCGTGTCTGCCCTTTCATTTTG 3’ |
Sequence-based reagent | SlpR2-2RP | This study | N/A | 5’ ATATATGCGGCCGCCCCAGCTAGCTCCCTTCACTCTTCT 3’ |
Sequence-based reagent | SlpL1-5FP | This study | N/A | 5’ TTAGGCGCGCCGAATCGAAATGCTTCCCCGCCTCG 3’ |
Sequence-based reagent | SlpL1-5RP | This study | N/A | 5’ ATATATGCGGCCGCTGAACGTGCAACATCAAAGGCCGC 3’ |
Sequence-based reagent | SlpM1-FP | This study | N/A | 5’ TTAGGCGCGCCGCGGCCTTTGATGTTGCACGTTCA 3’ |
Sequence-based reagent | SlpM1-RP | This study | N/A | 5’ ATATATGCGGCCGCGGACAGTTCGGAATGTGCCTCGA 3’ |
Sequence-based reagent | Slpf1-FP | This study | N/A | 5’ TTAGGCGCGCCGAATCGAGTGGTGAGCGATAG 3’ |
Sequence-based reagent | Slpf1-RP | This study | N/A | 5’ ATATATGCGGCCGCTCTGATATTTTTCACGGCTCA 3’ |
Sequence-based reagent | Slpf2-FP | This study | N/A | 5’ TTAGGCGCGCCTTCGACCTTGTAGTGGCAAG 3’ |
Sequence-based reagent | Slpf2-RP | This study | N/A | 5’ ATATATGCGGCCGCCGGAGATCGGAAGGTTAGTG 3’ |
Sequence-based reagent | Slpf3-FP | This study | N/A | 5’ TTAGGCGCGCCTCTCCTTGTTGCTCCTCACA 3’ |
Sequence-based reagent | Slpf3-RP | This study | N/A | 5’ ATATATGCGGCCGCTGAACGTGCAACATCAAAGG 3’ |
Sequence-based reagent | d5778FP | This study | N/A | 5’ TTAGGCGCGCCTGGTCTTTTACGTTAATCTGGGCAGCT 3’ |
Sequence-based reagent | d5778RP | This study | N/A | 5’ ATATATGCGGCCGCACATTACGCATTGCATTCCTCCTCCTT 3’ |
Sequence-based reagent | d5778-850FP | This study | N/A | 5’ TTAGGCGCGCCCATTAACTCGAGTCTGGTTTCCGAT 3’ |
Sequence-based reagent | d5778-850RP | This study | N/A | 5’ ATATATGCGGCCGCCGTACATATTCTCCAGGAGTTCGGTC 3’ |
Sequence-based reagent | pJRLPseq3 | This study | N/A | 5’ AGATGGGTGAGGTGGAGTACG 3’ |
Sequence-based reagent | pJR12-TATA-seq | This study | N/A | 5’ AGCTGCGCTTGTTTATTTGCTTAG 3’ |
Sequence-based reagent | SuHDamFP | This study | N/A | 5’ ATATATGCGGCCGCAAATGAAGAGCTACAGCCAATTTAATTTAAACGCCGCC 3’ |
Sequence-based reagent | SuHDamRP | This study | N/A | 5’ AAAATACTCGAGTCAGGATAAGCCGCTACCATGACTATTCCATTGC 3’ |
Sequence-based reagent | DamseqFP1 | This study | N/A | 5’ TGAGGGGAGACATAGTACTGGT 3’ |
Sequence-based reagent | DamseqFP2 | This study | N/A | 5’ GAAGGTCTGGTTGAGCGCCATA 3’ |
Sequence-based reagent | pCFD5-u8772-gRFP1 | This study | N/A | 5’ GCGGCCCGGGTTCGATTCCCGGCCGATGCATCGAAATTTCCTGGTATTCGGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-u8772-gRRP1 | This study | N/A | 5’ CGCCTCGCCCAAATGCATTTTGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | pCFD5-u8772-gRFP2 | This study | N/A | 5’ AAATGCATTTGGGCGAGGCGGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-u8772-gRRP2 | This study | N/A | 5’ TTAGTTTGATTGTTTCGAAGTGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | pCFD5-u8772-gRFP3 | This study | N/A | 5’ CTTCGAAACAATCAAACTAAGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-u8772-gRRP3 | This study | N/A | 5’ ATTTTAACTTGCTATTTCTAGCTCTAAAACAAACTGGAAGTCATTGACCCTGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | pCFD5-d5778-gRFP1 | This study | N/A | 5’ GCGGCCCGGGTTCGATTCCCGGCCGATGCAATAAGTCCTTGGGTAATACGGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-d5778-gRRP1 | This study | N/A | 5’ AACATTTATCTAGGACATCTTGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | pCFD5-d5778-gRFP2 | This study | N/A | 5’ AGATGTCCTAGATAAATGTTGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-d5778-gRRP2 | This study | N/A | 5’ TGTTGGCAAGCGGCGCTTCATGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | pCFD5-d5778-gRFP3 | This study | N/A | 5’ TGAAGCGCCGCTTGCCAACAGTTTTAGAGCTAGAAATAGCAAG 3’ |
Sequence-based reagent | pCFD5-d5778-gRRP3 | This study | N/A | 5’ ATTTTAACTTGCTATTTCTAGCTCTAAAACTTTCGATATCCCAGCTCCTTTGCACCAGCCGGGAATCGAACCC 3’ |
Sequence-based reagent | u8772crdelFP | This study | N/A | 5’ TTGCAAATACTTTTTATTCAAGGAATCGAC 3’ |
Sequence-based reagent | u8772crdelRP | This study | N/A | 5’ AATCTCAAGTTTGGTGTTTGTAATTTTTGG 3’ |
Sequence-based reagent | d5778crdelFP | This study | N/A | 5’ CTATTGAAGGGCGGACATATTAGACAACAATTGGATCGCTTG 3’ |
Sequence-based reagent | d5778crdelRP | This study | N/A | 5’ CTGCATTCCATCCCGTCGCATCCTTGTC 3’ |
Sequence-based reagent | pJRGFPdelFP1 | This study | N/A | 5’ TTAGAGATGCATCTCAAAAAAATGGTGGGCATAATAGTGTTGTTTATATATATCAAAAATAACAAC 3’ |
Sequence-based reagent | pJRGFPdelRP1 | This study | N/A | 5’ CCACCGGTCGCCACCGACGTCAGC GGCCGGCCGC 3’ |
Sequence-based reagent | pJRGFPdelFP2 | This study | N/A | 5’ GTCGCGGCCGGCCGCTGACGTCGGTGGCGACCGGTGGATCGTTTAAACAGGCC 3’ |
Sequence-based reagent | pJRGFPdelRP2 | This study | N/A | 5’ CAATAACTCGAGGAGCGCCGGAGT ATAAATAGAGGCGCTTCGTCTACG 3’ |
Sequence-based reagent | pJRGFPdelseqFP | This study | N/A | 5’ CCATTATAAGCTGCAATAAACAAGTTAACAAC 3’ |
Sequence-based reagent | pJRGFPdelseqRP | This study | N/A | 5’ GTCGCTAAGCGAAAGCTAAGC 3’ |
Sequence-based reagent | U63seqfwd | This study | N/A | 5’ ACGTTTTATAACTTATGCCCCTAAG 3’ |
Sequence-based reagent | pCFD5seqrev | This study | N/A | 5’ GCACAATTGTCTAGAATGCATAC 3’ |
Sequence-based reagent | dpnenFP | This study | N/A | 5’ TTAGGCGCGCCCTTCGCTTTTGCCTG GTCGGCTCATCGG 3’ |
Sequence-based reagent | dpnenRP | This study | N/A | 5’ ATATATGCGGCCGCACGCCTCGTCCTGGCACCCTC 3’ |
Sequence-based reagent | NICDFP | This study | N/A | 5’ TATTTAACCGGTTATTATCAAATGTAGATGGCCTCGGAACCCTTG 3’ |
Sequence-based reagent | NICDRP | This study | N/A | 5’ ATAATAGTTTAAACATGAGTACGCAAAGAAAGCGGGCAC 3’ |
Sequence-based reagent | hscFP1 | This study | N/A | 5’ TATTTAACCGGTTATTATCAAATGTAGATGGCCTCGGAACCCTTG 3’ |
Sequence-based reagent | hscRP1 | This study | N/A | 5’ GGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGAATTCCAAAATGAGTACGCAAAGAAAGCGGGCAC 3’ |
Sequence-based reagent | hscFP2 | This study | N/A | 5’ GTGCCCGCTTTCTTTGCGTACTCATTTTGGAATTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCC 3’ |
Sequence-based reagent | hscRP2 | This study | N/A | 5’ ATAATAGTTTAAACGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCCCGC 3’ |
Genetic reagent (D. melanogaster) | UAS-ey -RNAi | Bloomington Drosophila Stock Centre | BDSC 32486; Symbol: CG1464; Flybase ID:FBgn0005558 | |
Genetic reagent (D. melanogaster) | UAS-Su(H)-RNAi | Vienna Drosophila Stock Centre | VDRC 103597 Symbol: CG3497; Flybase ID: FBgn0004837 | |
Genetic reagent (D. melanogaster) | UAS-N-RNAi | Bloomington Drosophila Stock Centre | BDSC 7078; Symbol: CG3936; Flybase ID: FBgn0004647 | |
Genetic reagent (D. melanogaster) | UAS-Dl-RNAi | Vienna Drosophila Stock Centre | VDRC 32788; Symbol: CG3619; Flybase ID: FBgn0000463 | |
Genetic reagent (D. melanogaster) | UAS-PCNA-RNAi | Vienna Drosophila Stock Centre | VDRC 51253; Symbol: CG9193; Flybase ID: FBgn0005655 | |
Genetic reagent (D. melanogaster) | UAS-mam-DN | Justin Kumar | Symbol: CG8118; Flybase ID: FBgn0002643 | Justin Kumar |
Genetic reagent (D. melanogaster) | UAS-stg-RNAi | Vienna Drosophila Stock Centre | VDRC 17760; Symbol: CG1395 Flybase ID: FBgn0003525 | |
Genetic reagent (D. melanogaster) | UAS-dap | Bloomington Drosophila Stock Centre | BDSC 83338; Symbol: CG1772 Flybase ID: FBgn0010316 | |
Genetic reagent (D. melanogaster) | UAS-scro-RNAi | Bloomington Drosophila Stock Centre | BDSC 33890; Symbol: CG17594 Flybase ID: FBgn0287186 | |
Genetic reagent (D. melanogaster) | UAS-Ey | Bloomington Drosophila Stock Centre | BDSC56560 | |
Genetic reagent (D. melanogaster) | UAS-Scro | FlyORF | F000666 | |
Genetic reagent (D. melanogaster) | GMR35H02-Gal4 | Bloomington Drosophila Stock Centre (Pfeiffer et al., 2008) | BDSC 49923 | |
Genetic reagent (D. melanogaster) | GMR41H10-Gal4 (SoxN-Gal4) | Bloomington Drosophila Stock Centre (Pfeiffer et al., 2008) | N/A | No longer available from BDSC |
Genetic reagent (D. melanogaster) | UAS-GFP-nls | Bloomington Drosophila Stock Centre | BDSC 4776 | |
Genetic reagent (D. melanogaster) | UAS-EGFP-RNAi | Bloomington Drosophila Stock Centre | BDSC 9931 | |
Genetic reagent (D. melanogaster) | ayGal4 “y w hsFLP; act >y +> Gal4 UAS-GFP / CyO” | Ito et al., 1997 PMID:9043058 DOI: 10.1242/dev.124.4.761 | N/A | |
Genetic reagent (D. melanogaster) | “y w hs FLP; act >y +> Gal4 UAS GFP / CyO; UASDCR2/TM6B” | Zhu et al., 2022 PMID:35273186 DOI: 10.1038/s41467-022-28915-3 | N/A | |
Genetic reagent (D. melanogaster) | ayGal4 UASlacZ | Bloomington Drosophila Stock Centre | BDSC 4410 | |
Genetic reagent (D. melanogaster) | “y,w, hsFLP, UASCD8GFP; FRT40A tubGal80; tubGal4/TM6B” | Liqun Luo | N/A | |
Genetic reagent (D. melanogaster) | “y,w,; UbiRFPnls FRT40A/CyO” | Bloomington Drosophila Stock Centre | BDSC 34500 | |
Genetic reagent (D. melanogaster) | FRT40A slpS37A /SM6-TM6B | Sato and Tomlinson, 2007 PMID:17215299 DOI: 10.1242/dev.02786 | N/A | Andrew Tomlinson |
Genetic reagent (D. melanogaster) | E(spl)mγGFP | Almeida and Bray, 2005 PMID:16275038 DOI: 10.1016 /j.mod.2005.08.004 | N/A | |
Genetic reagent (D. melanogaster) | “VsxGal4;Dpn-LacZ/CyO; UAS-Dcr2/TM6B” | Erclik et al., 2017 PMID:28077877 DOI: 10.1038/nature20794 | N/A | |
Genetic reagent (D. melanogaster) | dpn-Gal4 (GMR13C02) | Bloomington Drosophila Stock Centre | BDSC47859 | |
Genetic reagent (D. melanogaster) | repo-Gal4 | Bloomington Drosophila Stock Centre | BDSC7415 | |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Sp/CyO; u8772 220 GFP/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Sp/CyO; d5778 850 GFP/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-Ey-1d/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-Ey-2m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-SuH-1–4 m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-SuH-1m4m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-Scro-1m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 220-Slp1-1m2m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-Ey-1m2d3d/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-SuH-1m3m6m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-SuH-1m2m3m6m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-SuH-1–6 m/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-Scro-1-7d/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; 850-Slp1-1d/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; UAS-DamEy/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w, hsFlp; Sp/CyO; UAS-SuHDam/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Sp/CyO; UAS-Dam/ Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “Dcr2; tubG80ts; SoxNG4” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “Dcr2; Su(H)RNAi/CyO; u8772-220-GFP/ Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “Dcr2; Su(H)RNAi/CyO; d5778-850-GFP/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Sp/CyO; UAS-eyRNAi/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Sp/CyO; UAS-eyRNAi/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; ayGal4 UASlacZ/CyO; UAS-eyRNAi/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; ayGal4 UASlacZ/CyO; hsNICD/Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Ubi RFPnls FRT40A; u8772-220-GFP/Sm6-Tm6B “ | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; Ubi RFPnls FRT40A; d5778-850-GFP/Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS Dc2; dpn-Gal4 /Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS Dc2; repo-Gal4 /Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS GFP RNAi; d5778-850-GFP /Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS GFP RNAi; 850-SuH-1m3m6m/Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS GFP RNAi; 850-SuH-1m2m3m6m/Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; UAS GFP RNAi; 850-SuH-1–6 m/Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and Methods’ |
Genetic reagent (D. melanogaster) | “y,w,hsFlp; ayGal4 UAS PCNA RNAi; hsNICD/ Sm6-Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ and ‘Making of transgenic fly stocks’ in ‘Materials and methods’ |
Genetic reagent (D. melanogaster) | “VsxGal4; E(spl) mγGFP/ CyO; UAS Dc2 /Tm6B” | This study | N/A | See section on ‘Fly stocks and genetics’ in ‘Materials and methods’ |
Genetic reagent (D. melanogaster) | y, w, nos-Cas9 | Bloomington Drosophila Stock Centre | BL54591 | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and methods’ |
Genetic reagent (D. melanogaster) | “y, w; PBAC{y[+]-attP-9A}VK00027” | Bloomington Drosophila Stock Centre | BL9744 | See section on ‘Fly stocks’ and ‘Making of transgenic fly stocks’ in ‘Materials and methods’ |
Sequence-based reagent | Stellaris-Quasar 570-conjugated slp2 mRNA probes | This study | Symbol: CG2939-RA; Flybase ID: FBtr0077500 | See section ‘Fluorescence in situ hybridization’ in ‘Materials and methods’ |
Sequence-based reagent | Stellaris-Quasar 670- conjugated slp1 mRNA probes | This study | Symbol: CG16738-RA; Flybase ID: FBtr0077499 | See section ‘Fluorescence in situ hybridization’ in ‘Materials and methods’ |
Peptide, recombinant protein | AscI | New England Biolabs | Catalog_#: R0558S | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Peptide, recombinant protein | NotI-HF | New England Biolabs | Catalog_#: R3189S | See section ‘Plasmid constructs ’in ‘Materials and methods’ |
Peptide, recombinant protein | XhoI | New England Biolabs | Catalog_#: R0146S | See section ‘Plasmid constructs ’in ‘Materials and methods’ |
Peptide, recombinant protein | AgeI-HF | New England Biolabs | Catalog_#: R3552S | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Peptide, recombinant protein | PmeI | New England Biolabs | Catalog_#: R0560S | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Peptide, recombinant protein | ZraI | New England Biolabs | Catalog_#: R0659S | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Commercial assay or kit | NEB Builder HiFi DNA Assembly kit | New England Biolabs | E2621L | See section ‘Plasmid constructs ’in ‘Materials and methods’ |
Commercial assay or kit | Expand High Fidelity PCR System, dNTPack | Roche | 04738268001 | See section ‘Plasmid constructs ’in ‘Materials and methods’ |
Commercial assay or kit | Platinum SuperFi II PCR mastermix | Invitrogen | 12368010 | See section ‘Plasmid constructs ’in ‘Materials and methods’ |
Commercial assay or kit | REDExtract-N-Amp PCR ReadyMix | Sigma-Aldrich | R4775-1.2ML | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Commercial assay or kit | DNeasy Blood and Tissue Kit | Qiagen | 69,504 | See section ‘Plasmid constructs ’ in ‘Materials and methods’ |
Peptide, recombinant protein | DpnI | New England Biolabs | Catalog_#: R0176S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | DpnII | New England Biolabs | Catalog_#: R0543S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | AlwI | New England Biolabs | Catalog_#: R0513S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | Quick Ligation kit | New England Biolabs | Catalog_#: M2200S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | T4 DNA ligase | New England Biolabs | Catalog_#: M0202S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | T4 DNA polymerase | New England Biolabs | Catalog_#: M0203S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | Klenow fragment | New England Biolabs | Catalog_#: M0210S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | Klenow 3’->5’ exo-enzyme | New England Biolabs | Catalog_#: M0201S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | NEBNext High-Fidelity 2 X PCR master mix | New England Biolabs | Catalog_#: M0541S | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | Advantage 2 cDNA polymerase | Clontech | Catalog_#: A63880 | See section ‘DamID-seq’ in ‘Materials and methods’ |
Peptide, recombinant protein | RNase A | Roche | Catalog_#: 11119915001 | See section ‘DamID-seq’ in ‘Materials and methods’ |
Commercial assay or kit | Qubit dsDNA HS assay kit | Invitrogen | Catalog_#: Q32851 | See section ‘DamID-seq’ in ‘Materials and methods’ |
Commercial assay or kit | Agencourt AMPure XP beads | Beckman-Coulter | Catalog_#: A63880 | See section ‘DamID-seq’ in ‘Materials and methods’ |
Sequence-based reagent | AdRt oligo | Marshall and Brand, 2015 PMID:27490632DOI: 10.1038/nprot.2016.084 | N/A | 5’ CTAATACGACTCA CTATAGGGCAG CGTGGTCGC GGCCGAGGA 3’ |
Sequence-based reagent | AdRb oligo | Marshall and Brand, 2015 PMID:27490632 DOI: 10.1038/nprot.2016.084 | N/A | 5’ TCCTCGGCCG 3’ |
Sequence-based reagent | DamID_PCR oligo | Marshall and Brand, 2015 PMID:27490632 DOI: 10.1038/nprot.2016.084 | N/A | 5’ GGTCGCGG CCGAGGATC 3’ |
Sequence-based reagent | NGS_PCR1 | Marshall and Brand, 2015 PMID:27490632 DOI: 10.1038/nprot.2016.084 | N/A | 5’ AATGATACGGC GACCACCGA*G 3’ *=phosphorothioate linkage |
Sequence-based reagent | NGS_PCR2 | Marshall and Brand, 2015 PMID:27490632 DOI: 10.1038/nprot.2016.084 | N/A | 5’ CAAGCAGAAGA CGGCATACGA*G 3’ *=phosphorothioate linkage |
Sequence-based reagent | NGS_adaptors | Marshall and Brand, 2015 PMID:27490632 DOI: 10.1038/nprot.2016.084 | N/A | |
Software, algorithm | FIMO based web-application | Bart Deplancke | Site: https://biss.epfl.ch | |
Software, algorithm | FIMO | Grant et al., 2011 PMID:21330290 DOI: 10.1093/bioinformatics/btr064 | Site: https://meme-suite.org/meme Versions 4.11.1–5.4.1 | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and methods’. |
Software, algorithm | The MEME suite | Bailey et al., 2015 PMID:25953851 DOI: 10.1093/nar/gkv416 | Site: https://meme-suite.org/meme Versions 4.11.1–5.4.1 | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and methods’. |
Software, algorithm | TOMTOM | Gupta et al., 2007 PMID:17324271 DOI: 10.1186/gb-2007-8-2-r24 | Site: https://meme-suite.org/meme Versions 4.11.1–5.4.1 | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and methods’. |
Software, algorithm | JASPAR | Sandelin et al., 2004 PMID:14681366 doi: 10.1093/nar/gkh012 | Site: https://jaspar.genereg.net/ releases 6, 7, 8,9. | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and methods’. |
Software, algorithm | Fly Factor Survey | Zhu et al., 2011 PMID:21097781 DOI: 10.1093/nar/gkq858 | Site: https://mccb.umassmed.edu/ffs | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and Methods’. |
Software, algorithm | Sequence Manipulation Suite Version 2 | Stothard, 2000 PMID:10868275 DOI: 10.2144/00286ir01 | Site: https://www.bioinformatics.org/sms2 | Accessed between 2016 to 2022; See section ‘Bioinformatic analysis’ in ‘Materials and Methods’. |
Software, algorithm | Primer3web version 4.1.0 | Site: https://bioinfo.ut.ee/primer3 | Primer3web version 4.1.0 | |
Software, algorithm | damidseq_pipeline | Marshall and Brand, 2015 PMID:26112292 DOI: 10.1093/bioinformatics/btv386 | Site: http://owenjm.github.io/damidseq_pipeline Version: v1.4.6 | See section ‘DamID-seq data analysis’ in ‘Materials and Methods’. |
Software, algorithm | Irreproducibility Discover Rate (IDR) | Nathan Boley | Site: https://github.com/nboley/idr Version: 2.0.3 | See section ‘DamID-seq data analysis’ in ‘Materials and Methods’. |
Software, algorithm | Integrated Genomics Viewer (IGV) | Robinson, J.T., et al. (2012) PMID:21221095 doi: 10.1038/nbt.1754 | IGV_Linux_2.11.0 | See section ‘DamID-seq data analysis’ in ‘Materials and Methods’. |
Software, algorithm | DAVID | Site: https://david.ncifcrf.gov | Releases 6.8 and Dec 2021 | See section ‘DamID-seq data analysis’ in ‘Materials and Methods’. |
Software, algorithm | FIJI | Schindelin et al., 2012 PMID:22743772 doi: 10.1038/nmeth.2019 | FIJI version 2.3.051 | See section ‘Image analysis’ in ‘Materials and Methods’. |
Software, algorithm | GraphPad Prism | GraphPad | GraphPad Prism version 9.2.0 | See section ‘DamID-seq data analysis’ in ‘Materials and Methods’. |
Software, algorithm | Adobe Photoshop | Adobe | Adobe Photoshop 2022 version: 23.4.1 | |
Software, algorithm | Adobe Illustrator | Adobe | Adobe Illustrator 2022 Version 26.3.1 | |