Hypoxia-inducible factor 1 signaling drives placental aging and can provoke preterm labor
- Department of Anesthesia, Critical Care, and Pain Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, United States
- Division of Endocrinology, Beth Israel Deaconess Medical Center, Harvard Medical School, United States
- Department of Medicine, Cedars-Sinai Medical Center, United States
- Division of Nephrology, Departments of Internal Medicine and Pharmacology, University of Texas Southwestern Medical School, United States
Figures
Figure 1
Systematic search flow for placental transcriptomics datasets.
326 Gene Expression Omnibus (GEO) datasets were identified by the search terms ‘placenta’ and ‘transcriptome’; nine met criteria for containing placental transcriptomic data representing normal physiology at a range of gestational timepoints spanning through the final 1/3 of pregnancy. Dataset selected for further analysis in yellow.
Figure 2 with 1 supplement
Mouse placental aging is characterized by cellular senescence, hypoxia-inducible factor 1 (HIF-1) signaling, and mitochondrial dysregulation.
Weighted gene correlation network analysis (WGCNA) yielded 20 gene clusters. Functional pathways overrepresented in clusters found to increase (blue) and decrease (turquoise) across gestation highlight enhanced cellular senescence, increased HIF-1 signaling, and decreased mitochondrial synthesis and respiration late in pregnancy (A). mRNA expression of senescence marker Glb1 peaks at e17.5 (B; one-way ANOVA p=0.0048). HIF-1 protein abundance is higher at e17.5 versus e13.5 and e15.5 (C; one-way ANOVA p=0.019), as is expression of HIF-1 targets Hk2 and Slc2a1 (D; two-way ANOVA p<0.0001 for gestational age factor). (See Figure 2—figure supplement 1 for analysis of gene expression changes across timepoints by placental sex.) Mitochondrial abundance, reflected by COX IV protein, decreases with gestational age (E, one-way ANOVA p=0.0064), and mitochondrial DNA lesion rate peaks at e17.5 in the regions of the D-loop (one-way ANOVA p=0.0001), COII/ATPase6 (p=0.0027), and ND5 (p=0.036) (F). (B–F) Each data point represents a biological replicate (e.g. RNA, protein, or DNA extracted from an individual placenta, in turn collected from one of 2–4 pregnant dams per group). Data normalized to mean at e13.5. See Figure 2—source data 1 for uncropped blots.
-
Figure 2—source data 1
Uncropped, unedited blots from 2c (left) and 2e (right).
- https://cdn.elifesciences.org/articles/85597/elife-85597-fig2-data1-v1.zip
Figure 2—figure supplement 1
Gestational age-dependent variability in expression of hypoxia-inducible factor 1 (Hif-1) target Slc2a1, but not Hk2, is affected by placental sex.
Subgroup analysis did not reveal sex-dependent mRNA expression changes in Glb1 (A) or Hk2 (B) by qPCR, but did demonstrate consistently higher Slc2a1 expression in male placentas at all gestational ages and an interaction between the effects of sex and gestational age on Slc2a1 expression (C; two-way ANOVA p<0.0001 for sex, p<0.0001 for gestational age, and p=0.028 for interaction). Each data point represents a biological replicate (RNA isolated from an individual placenta, collected from one of 2–4 dams per group). Data normalized to collective (M+F) mean at e13.5.
Figure 3
Senescence, hypoxia-inducible factor 1 (HIF-1) signaling, and decreased mitochondrial abundance characterize late-gestation human placenta.
mRNA expression of senescence marker GLB1 and HIF-1 targets HK2 and SLC2A1 trends higher in placentas from >39-week cohort vs <35-week cohort (A; two-way ANOVA gestational age factor p=0.057). Mitochondrial abundance, reflected by mitochondrial genes ATP6 and COX2 (B; two-way ANOVA gestational age factor p=0.042) and COX IV protein (C; p=0.0036) decreases with advancing gestational age. Each data point represents a biological replicate (RNA or protein isolated from an individual placenta). Data normalized to mean in <35-week group. See Figure 3—source data 1 for uncropped blots.
-
Figure 3—source data 1
Uncropped, unedited blots from Figure 3.
- https://cdn.elifesciences.org/articles/85597/elife-85597-fig3-data1-v1.zip
Figure 4
Short-term hypoxia-inducible factor 1 (HIF-1) stabilization in primary mouse trophoblasts leads to decreased mitochondrial abundance and cellular senescence.
HIF-1 is detected in cultured trophoblasts exposed to CoCl2 (A). After 48 hr of CoCl2 exposure, trophoblasts exhibit decreased mitochondrial abundance reflected by Cox2 mRNA expression levels (B; p=0.014) and COX IV protein levels (C; p=0.0047). Senescence marker Glb1 is increased (D; p=0.038) and senescence-associated beta galactosidase (SA-βGal) accumulation is noted by X-gal assay (E; p=0.012). Each data point represents a technical replicate (e.g. protein, RNA, or β-Gal measured from an individual well of cells grown in treated or control condition). Data normalized to mean of control treatment group. See Figure 4—source data 1 for uncropped blots.
-
Figure 4—source data 1
Uncropped, unedited blots from 4a (left) and 4c (right).
- https://cdn.elifesciences.org/articles/85597/elife-85597-fig4-data1-v1.zip
Figure 5 with 3 supplements
Long-term hypoxia-inducible factor 1 (HIF-1) stabilization in JAR cells leads to mitochondrial dysfunction, cellular senescence, and metabolic reprogramming.
HIF-1 is stabilized at 6-day timepoint of CoCl2 exposure (A). After 6 days, mitochondrial abundance is decreased as reflected by a drop in the mitochondrial:nuclear DNA copy number (B) and a decrease in COX IV protein (C). (See Figure 5—figure supplement 1 for timecourse of declining mitochondrial abundance.) Cells also exhibit augmented signs of mitochondrial dysfunction via MtSox (D; p=0.0003) and tetramethylrhodamine ethyl ester (TMRE) staining (E; two-way ANOVA CoCl2 factor p<0.0001). Senescence-associated beta galactosidase (SA-βGal) staining reflects a high proportion of senescent cells (F; p<0.0001) and growth arrest is confirmed by cell counting following a 6-day pre-treatment with CoCl2 (G; two-way ANOVA p<0.0001 for interaction of CoCl2 factor with time). (See Figure 5—figure supplement 2 for assessment of cell death by propidium iodide staining.) mRNA expression of senescence-associated secretory phenotype (SASP) candidates VEGF, TNFA, IL1A, and IL10 is altered after CoCl2 exposure (H; *, adjusted p<0.01). RNA-Seq revealed upregulation of 2188 and downregulation of 1389 genes (I; genes with |log2(FC)|>1 and -log(FDR)>2 indicated in red) after CoCl2 treatment, with gene set enrichment analysis revealing several pathways significantly dysregulated after CoCl2 treatment recapitulating changes seen in transcriptomic analysis of late versus early gestation mouse placenta. Scale marker = 200 μm. FCCP = carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, an ionophore uncoupler of oxidative phosphorylation which depolarizes mt membrane potential. See Figure 5—figure supplement 3 for assessment of effects of HIF-1 stabilization in JAR cells using dimethyloxalyl glycine (DMOG). Each data point represents a technical replicate (measurement from an independent well of cells grown in treatment vs control condition). Data normalized to mean of control group. See Figure 5—source data 1 for uncropped blots.
-
Figure 5—source data 1
Uncropped, unedited blots from 5a (left) and 5c (right).
- https://cdn.elifesciences.org/articles/85597/elife-85597-fig5-data1-v1.zip
Figure 5—figure supplement 1
The mitochondrial effects of hypoxia-inducible factor 1 (HIF-1) stabilization in JAR cells begin to appear on day 3 following CoCl2 exposure.
Each data point represents a technical replicate (independent well of cells grown in control vs treatment condition).
Figure 5—figure supplement 2
Increased number of JAR cells stain with propidium iodide, but the absolute number remains low following 6 days of CoCl2 treatment.
Each data point represents a technical replicate (independent well of cells grown in control vs treatment condition).
Figure 5—figure supplement 3
Dimethyloxalyl glycine (DMOG) stabilizes hypoxia-inducible factor 1 (HIF-1) in JAR cells (A) and induces similar effects as CoCl2 on COX IV protein (B), senescence-associated beta galactosidase (SA-βGal) expression (C), and cell growth (D) after 4 days.
Each data point represents a technical replicate (measurement from an independent well of cells grown in treatment vs control condition). See Figure 5—source data 1 for uncropped blots.
Figure 6
Conditioned media (CM) from JAR cells following hypoxia-inducible factor 1 (HIF-1) stabilization induces expression of contractile-associated proteins and augments contraction in immortalized human uterine myocytes.
hTERT-HM mRNA expression of PTGS2 (A), GJA1 (B), PTGFR (C), and IL6 (D) was induced by CM from JAR cells following CoCl2 treatment (but not in control conditions), potentiating the effect of stimulation of myocytes by exogenous IL-1β. Data normalized to mean of null treatment group. Percent well area occupied by hTERT-HM cells embedded in collagen matrix is significantly smaller after stimulation with IL-1β plus JAR CM from CoCl2 condition, reflecting greater degree of hTERT-HM cellular contraction (E). Each data point represents a technical replicate (measurement from an independent well of cells grown in treatment vs control condition).
Figure 7
Maternal dimethyloxalyl glycine (DMOG) injection on e16.5 stabilizes placental hypoxia-inducible factor 1 (HIF-1) and induces preterm labor.
HIF-1α protein is detected in placental lysates 12 hr following DMOG injection but not vehicle (A). mRNA expression of HIF-1 targets Hk2 and Slc2a1 is upregulated following DMOG injection (p=0.002 for DMOG vs vehicle, two-way ANOVA) (B). Gestational length is significantly shortened following DMOG injection versus vehicle (C–D). Each data point represents a biological replicate (in A and B, each measurement from an individual placenta collected from one of two pregnant dams). Data normalized to mean of vehicle group. See Figure 7—source data 1 for uncropped blots.
-
Figure 7—source data 1
Uncropped, unedited blots from Figure 7.
- https://cdn.elifesciences.org/articles/85597/elife-85597-fig7-data1-v1.zip
Author response image 1
Tables
Table 1
Maternal and fetal characteristics.
Data summarized by mean ± SEM or n (%). p-Values calculated via t-test (continuous variables) or Chi-square contingency table (categorical variables).
| <35 weeks | >39 weeks | p-Value | |
|---|---|---|---|
| n=9 | n=11 | ||
| Gestational age at delivery (weeks) | 34.0±0.3 | 39.5±0.1 | <0.0001 |
| Maternal age (years) | 31.9±0.9 | 36.2±1.0 | 0.008 |
| Maternal BMI >40 | 1 (11) | 0 (0) | 0.26 |
| Maternal race | |||
| White | 7 (78) | 9 (82) | 0.13 |
| Black | 2 (22) | 0 (0) | |
| Asian | 0 (0) | 2 (18) | |
| Primiparous | 4 (44) | 4 (36) | 0.71 |
| Female neonate | 5 (55) | 8 (73) | 0.42 |
| Indication for delivery | Placenta previa (3) | Scheduled repeat (7) | |
| Vasa previa (4) | Breech presentation (3) | ||
| Thinned lower uterine segment (2) | Elective (1) |
Table 2
Primers.
| Mouse | ||
|---|---|---|
| Target | Sequence | Platform |
| Glb1 | Mm00515342_m1 | TaqMan |
| Hk2 | Mm00443385_m1 | TaqMan |
| Slc2a1 | Mm00441473_m1 | TaqMan |
| D loop (long, 801 bp amplicon) | F: CGTACATTAAACTATTTTCCCCAAG R: GAGTTTTGGTTCACGGAACAT | SYBR |
| COII/ATPase 6 (long, 855 bp amplicon) | F: TTGGTCTACAAGACGCCACA R: ATTTTGGTGAAGGTGCCAGT | SYBR |
| Nd5 (long, 930 bp amplicon) | F: CGCCTACTCCTCAGTTAGCC R: ATGGTGACTCAGTGCCAGGT | SYBR |
| Nd2/Nd1 (long, 832 bp amplicon) | F: GGATGAGCCTCAAACTCCAA R: ATGATGGCAAGGGTGATAGG | SYBR |
| D loop (short) | F: TGACTATCCCCTTCCCCATT R: TTGTTGGTTTCACGGAGGAT | SYBR |
| COII/ATPase 6 (short) | F: TCTCCCCTCTCTACGCATTC R: CGGTTAATACGGGGTTGTTG | SYBR |
| Nd5 (short) | F: GGCCTCACATCATCACTCCT R: GCTGTGGATCCGTTCGTAGT | SYBR |
| Nd2/Nd1 (short) | F: GGATGAGCCTCAAACTCCAA R: GGCTCGTAAAGCTCCGAATA | SYBR |
| Actb | Mm00607939_s1 | TaqMan |
| Human | ||
| HK2 | Hs00606086_m1 | TaqMan |
| SLC2A1 | Hs00892681_m1 | TaqMan |
| IL1A | Hs00174092_m1 | TaqMan |
| IL1B | Hs01555410_m1 | TaqMan |
| TNFA | Hs00174128_m1 | TaqMan |
| IL6 | Hs00174131_m1 | TaqMan |
| IL10 | Hs00961622_m1 | TaqMan |
| MT-ATP6 | Hs02596862_g1 | TaqMan |
| MT-COX2 | Hs02596865_g1 | TaqMan |
| ND1 | F: CCATAAAACCCGCCACACT R: GAGCGATGGTGAGAGCTAAGGT | SYBR |
| 18S | F: CGCAGCTAGGAATAATGGAATAGG R: CATGGCCTCAGTTCCGAAA | SYBR |
| GJA1 | Hs.PT.58.38338544 | SYBR |
| PTGS2 | Hs.PT.58.77266 | SYBR |
| ACTB | Hs.PT.39a.22214847 | SYBR |
| YWHAZ | Hs01122445_g1 | TaqMan |
Table 3
Antibodies.
| Antibody | Species | Working concentration | Source |
|---|---|---|---|
| CoxIV | Mouse IgG mAb | 1:1000 | Cell Signaling Technology, #11967S |
| β-Actin-HRP conjugate | Rabbit IgG mAb | 1:2000 | Cell Signaling Technology, # 5125S |
| HIF-1 | Rabbit | 1:1000 | Cell Signaling Technology, #14179S |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Hypoxia-inducible factor 1 signaling drives placental aging and can provoke preterm labor
eLife 12:RP85597.
https://doi.org/10.7554/eLife.85597.3
