Proteolytic cleavage and inactivation of the TRMT1 tRNA modification enzyme by SARS-CoV-2 main protease
Figures

Human cells infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) exhibit a reduction in tRNA methyltransferase 1 (TRMT1) levels and perturbations in tRNA modification patterns.
(A) Immunoblot analysis of lysates prepared from MRC-5-ACE2 human cells that were mock-infected or infected with SARS-CoV-2 at multiplicity of infection (MOI) of 5 for 24 or 48 hr. The immunoblot was probed with anti-TRMT1, actin, or SARS-CoV-2 nucleocapsid (N) antibodies. Circle represents endogenous full-length TRMT1. Asterisk (*) denotes a non-specific band. Size markers are noted in kiloDalton. (B) Quantification of TRMT1 signal intensity normalized to actin in the mock or SARS-CoV-2-infected cell lines. TRMT1 protein levels are expressed relative to mock-infected samples for each time point. (C) m2,2G levels in small RNAs isolated from MRC5 cells that were either mock-infected or infected with SARS-CoV-2 at MOI of 5 for 24 or 48 hr. m2,2G levels were normalized to A, C, G, and U. Samples were measured in biological replicates. Statistical significance for (B) and (C) was determined by two-way ANOVA with multiple comparisons test. ***p<0.001; ****p<0.0001; ns, non-significant. (D) Levels of the indicated RNA modifications in small RNAs isolated from MRC5 cells that were either mock-infected or infected with SARS-CoV-2 for 24 or 48 hr. RNA modification levels were normalized to A, C, G, and U. Y-axis represents the log2 fold change in the levels of the indicated tRNA modification between SARS-CoV-2 infected versus mock-infected MRC5 cells. The experiment in (C) was repeated as an independent biological replicate in Figure 1—figure supplement 1.
-
Figure 1—source data 1
Raw uncropped immunoblots for Figure 1A.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig1-data1-v1.zip
-
Figure 1—source data 2
LC-MS measurements of RNA modifications.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig1-data2-v1.zip

LC-MS analysis of dimethylguanosine (m2,2G) levels in small RNAs isolated from MRC5 cells that were either mock-infected or infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) at multiplicity of infection (MOI) of 5 for 24 or 48 hr.
m2,2G levels were normalized to guanosine. Samples were measured in biological replicates. Statistical significance was determined by two-way ANOVA with multiple comparisons test. *p<0.05; ns, non-significant.
-
Figure 1—figure supplement 1—source data 1
LC-MS measurements of RNA modifications.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig1-figsupp1-data1-v1.xls

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nonstructural protein 5 (Nsp5) binds tRNA methyltransferase 1 (TRMT1) in human cells.
(A) Schematic of human TRMT1 primary structure with predicted Nsp5 cleavage site. Mitochondrial targeting signal (MTS), methyltransferase (MT) domain, and zinc finger motif are denoted. (B) Consensus sequence logo of cleavage sites in SARS-CoV-2 polyproteins. (C) Alpha-fold predicted structure of human TRMT1 with putative Nsp5 cleavage site denoted in magenta and arrowhead. (D) Immunoblot of input and strep-tactin purifications from human cells expressing empty vector, wild-type (WT) Nsp5, or Nsp5-C145A fused to the Strep-tag without or with co-expression with TRMT1-FLAG. The immunoblot was probed with anti-Strep, FLAG, and actin antibodies. Square represents TRMT1-FLAG, circle represents endogenous TRMT1. Size markers are noted to the left in kiloDalton. The experiment in (D) was repeated as an independent biological replicate in Figure 2—figure supplement 1.
-
Figure 2—source data 1
Raw uncropped immunoblots for Figure 2D.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig2-data1-v1.zip

Immunoblot of input and strep-tactin purifications from human cells expressing empty vector, wild-type (WT) nonstructural protein 5 (Nsp5), or Nsp5-C145A fused to the Strep-tag without or with co-expression with tRNA methyltransferase 1 (TRMT1)-FLAG.
The immunoblot was probed with anti-TRMT1, Strep, or actin antibodies. Circle represents endogenous TRMT1.
-
Figure 2—figure supplement 1—source data 1
Raw uncropped immunoblots for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig2-figsupp1-data1-v1.zip

Nonstructural protein 5 (Nsp5) expression induces cleavage of tRNA methyltransferase 1 (TRMT1) in human cells.
(A) Immunoblot of lysates prepared from human 293T cells expressing GFP, Nsp5 or Nsp5-C145A. The immunoblot was probed with anti-TRMT1, Strep, or actin antibodies. Hours post represents the time post-transfection. Circle represents endogenous TRMT1. Arrow represents the N-terminal (N)-TRMT1 cleavage fragment. Asterisk (*) denotes a non-specific band. Size markers to the left in kiloDalton. (B, C) Quantification of endogenous TRMT1 or N-terminal (N)-TRMT1 cleavage product in transfected cells. TRMT1 and N-TRMT1 signal was normalized to actin. (D) Immunoblot of lysates prepared from wild-type or TRMT1-knockout (KO) human cell lines expressing Nsp5. Experiments in (A) and (D) were repeated three times in biological replicates (see source data).
-
Figure 3—source data 1
Raw uncropped immunoblots for Figure 3.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig3-data1-v1.zip

Sequence-dependent cleavage of tRNA methyltransferase 1 (TRMT1) by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nonstructural protein 5 (Nsp5).
(A) Immunoblot of lysates from human cells expressing empty vector, wild-type (WT) Nsp5-Strep, or Nsp5-C145A-Strep without or with co-expression with TRMT1-FLAG. The immunoblot was probed with anti-Strep, FLAG, and actin antibodies. Square represents TRMT1-FLAG, Asterisk (*) denotes a non-specific band, arrow represents N-terminal TRMT1 cleavage product and arrowhead indicates the C-terminal TRMT1 cleavage product. (B) Schematic of human TRMT1 with predicted Nsp5 cleavage site and Q530N mutation. (C) Immunoblot of lysates from human cells expressing empty vector, wild-type (WT) Nsp5-Strep, or Nsp5-C145A-Strep without or with co-expression with TRMT1-FLAG or TRMT1-FLAG Q530N. Experiments in (A) and (C) were repeated three times as biological replicates with comparable results (see source data).
-
Figure 4—source data 1
Raw uncropped immunoblots for Figure 4.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig4-data1-v1.zip

Detection of the C-terminal tRNA methyltransferase 1 (TRMT1) fragment produced by nonstructural protein 5 (Nsp5)-dependent cleavage in human cells.
(A) Immunoblot of lysates from the indicated wild-type (WT) or TRMT1-knockout (K)O human 293T cells that were untransfected (-) (lanes 1 and 2) or transfected with empty vector, wild-type (WT) Nsp5-Strep, or Nsp5-C145A-Strep expression plasmids (lanes 3 through 5). The blot was probed with an antibody detecting residues 609–659 of TRMT1. Circle represents endogenous TRMT1. (B) Immunoblot of lysates from human cells that were transfected with TRMT1-FLAG or TRMT1-FLAG Q530N expression plasmids along with empty vector, wild-type (WT) Nsp5-Strep, or Nsp5-C145A-Strep expression plasmids. The blot was probed with an antibody detecting residues 609–659 of TRMT1. Circle represents endogenous TRMT1, square represents TRMT1-FLAG, and arrowhead indicates the C-terminal TRMT1 cleavage product. Asterisks (*) denote bands that are still detectable in the TRMT1-KO cell line. The band at ~35 kDa in lanes 3 and 6 of (B) represents non-specific detection of the Nsp5-C145A variant that exhibits extremely high levels of expression since it cannot self-cleave.
-
Figure 4—figure supplement 1—source data 1
Raw uncropped immunoblots for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig4-figsupp1-data1-v1.zip

N- and C-terminal tRNA methyltransferase 1 (TRMT1) cleavage fragments exhibit alterations in RNA binding and tRNA modification activity.
(A) Schematic of wild-type TRMT1 and predicted TRMT1 fragments resulting from nonstructural protein 5 (Nsp5) cleavage at Q530N. (B) Immunoblot analysis of anti-FLAG purifications from human cells expressing vector control, full-length TRMT1, or TRMT1 cleavage fragments fused to the FLAG tag. The immunoblot was probed with anti-FLAG and anti-actin antibodies. (C) Nucleic acid stain of RNAs extracted from the indicated input or purified samples after denaturing PAGE. The migration pattern of 5.8 S rRNA (~150 nt), 5 S rRNA (~120 nt), and tRNAs (~70–80 nt) are denoted. (D) Immunoblot of TRMT1 expression in either control-wild-type (WT) or TRMT1-knockout (KO) human 293T cell lines. (E, F) Representative gel of primer extension assays to monitor the presence of dimethylguanosine (m2,2G) in tRNA-Met-CAU or mt-tRNA-Ile-GAU from the cell lines transfected with the indicated TRMT1 constructs. D, dihydrouridine; m1G, 1-methylguanosine; >, labeled oligonucleotide used for primer extension. Protein-RNA purification was repeated with comparable results (see source data for repeat).
-
Figure 5—source data 1
Raw uncropped immunoblots for Figure 5.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig5-data1-v1.zip

Confocal microscopy images of 293T cells transiently transfected with constructs expressing tRNA methyltransferase 1 (TRMT1) or TRMT1 fragments fused with green fluorescent protein (GFP).
Mitochondria were identified using mitochondrion-targeted red fluorescent protein (Mito-RFP) and nuclear DNA was stained with Hoechst. Overlap of red mitochondria and green GFP signal is displayed in the Merge panels.
-
Figure 5—figure supplement 1—source data 1
Raw uncropped microscopy images for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig5-figsupp1-data1-v1.zip

The expression of tRNA methyltransferase 1 (TRMT1) affects the levels of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA replication in human cells.
(A) Immunoblot of lysates prepared from 293T control-wild-type (WT) or TRMT1-knockout (KO) cell lines that were mock-infected (multiplicity of infection, MOI of 0) or infected with SARS-CoV-2 at MOI of 0.2 or 0.4 for 24 hr. The immunoblot was probed with antibodies against TRMT1 or actin. Circle represents endogenous full-length TRMT1. Asterisk (*) denotes a non-specific band. Size markers to the right in kiloDalton. (B) Normalized TRMT1 signal intensity relative to mock-infected cells (MOI of 0). Statistical significance was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (C) Immunoblot of lysates prepared from 293T control-wild-type (WT) or TRMT1-KO cell lines that were mock-infected (MOI of 0) or infected with SARS-CoV-2 at MOI of 0.1 or 5.0 for 24 hr. The immunoblot was probed with antibodies as in (A). (D) Normalized TRMT1 signal intensity relative to mock-infected cells (MOI of 0). (E, F) SARS-CoV-2 RNA copy number in control-WT or TRMT1-KO human 293T cell lines after infection at the indicated MOI for 24 hr. Viral copy number was measured by QRT-PCR and normalized to GAPDH. Samples were measured in triplicate. Statistical significance was determined by two-way ANOVA with Šídák’s multiple comparisons test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, non-significant.
-
Figure 6—source data 1
Raw uncropped immunoblots for Figure 6.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig6-data1-v1.zip
-
Figure 6—source data 2
QRT-PCR measurements of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig6-data2-v1.xlsx

Human 293T cell lines expressing ACE2 can be infected by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
(A) Immunoblot analysis of lysates prepared from the indicated 293T cell lines expressing empty vector or ACE2. The immunoblot was probed with anti-ACE2 and actin. (B) Immunoblot analysis of lysates prepared from 293T-ACE2 cell lines that were mock-infected (multiplicity of infection, MOI 0) or infected with SARS-CoV-2 at the indicated MOI. The blot was probed against the SARS-CoV-2 nucleocapsid (N) and actin.
-
Figure 6—figure supplement 1—source data 1
Raw uncropped immunoblots for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig6-figsupp1-data1-v1.zip

tRNA methyltransferase 1 (TRMT1) is required for efficient severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) replication in human cells.
(A) Immunoblot of lysates prepared from the indicated 293T TRMT1-knockout (KO) cell lines that were mock-infected (multiplicity of infection, MOI of 0) or infected with SARS-CoV-2 for 24 hr. The immunoblot was probed with antibodies against TRMT1 or actin. Square represents full-length TRMT1-FLAG. Asterisk (*) denotes a non-specific band. Size markers to the left in kiloDalton. (B) Normalized TRMT1-WT signal intensity relative to mock-infected cells (MOI of 0). (C) Normalized TRMT1-Q530N signal intensity relative to mock-infected cells (MOI of 0). Statistical significance was determined in (B) and (C) by one-way ANOVA with Dunnett’s multiple comparisons test. (D) SARS-CoV-2 RNA copy number in control-wild-type (WT) or TRMT1-KO human 293T cell lines after infection at the indicated MOI. Viral copy number was measured by QRT-PCR and normalized to GAPDH. Statistical significance was determined by two-way ANOVA with Dunnett’s multiple comparisons test. *p<0.05; **p<0.01; ****p<0.0001; ns, non-significant.
-
Figure 7—source data 1
Raw uncropped immunoblots for Figure 7A.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig7-data1-v1.zip
-
Figure 7—source data 2
QRT-PCR measurements of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA for Figure 7D.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig7-data2-v1.xlsx

Expression of nonstructural protein 5 (Nsp5) leads to cleavage of tRNA methyltransferase 1 (TRMT1)-wild-type (WT) re-expressed in TRMT1-knockout (KO) cells, but not TRMT1-Q530N.
Immunoblot of lysates from human cells integrated with empty lentiviral vector or lentiviral expression vectors for wild-type (WT) TRMT1 or TRMT1-Q530N. The cell lines were transfected with either a vector or a construct expressing Nsp5-Strep. The immunoblot was probed with anti-TRMT1, Strep, and actin antibodies. Square represents TRMT1-FLAG, circle represent endogenous TRMT1, Asterisk (*) denotes a non-specific band, and arrow represents N-terminal TRMT1 cleavage product.
-
Figure 7—figure supplement 1—source data 1
Raw uncropped immunoblots for Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig7-figsupp1-data1-v1.zip

Immunoblot analysis of lysates prepared from the indicated 293T cell lines expressing empty vector or ACE2.
The immunoblot was probed with anti-ACE2 and actin.
-
Figure 7—figure supplement 2—source data 1
Raw uncropped immunoblots for Figure 7—figure supplement 2.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig7-figsupp2-data1-v1.zip

Viral infectivity measurement of supernatants collected from the indicated cell lines infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) for 24 hr.
(A) Viral titer of supernatants collected from the indicated cell lines infected with SARS-CoV-2. Infectious titer was determined by TCID50 endpoint dilution assay in VeroE6 cells and expressed in focus forming units per mL of supernatant (FFU/mL). (B) Infectivity of SARS-CoV-2 particles generated from cell lines in (A). Infectivity of viral particles was calculated with the formula [(FFU/mL)/(viral genomic RNA copies/mL)], and expressed in FFU per 100 genomic copies.
-
Figure 8—source data 1
Infectious titers and QRT-PCR results for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections.
- https://cdn.elifesciences.org/articles/90316/elife-90316-fig8-data1-v1.xlsx
Tables
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (Homo sapiens, female) | 293T | ATCC | ATCC: CRL-3216 | |
Cell line (Homo sapiens, male) | MRC5 +ACE2 | Raymonda et al., 2022 | ATCC: CCL-171 | |
Strain (coronavirus) | SARS-CoV-2 | BEI resources | NR-52282 | Isolate Hong Kong/VM20001061/2020 |
Strain (coronavirus) | SARS-CoV-2 | European Virus Archive | 014 V-03890 | Isolate BetaCoV/France/ IDF0372/2020 |
Commercial assay or kit | RNA Clean & Concentrator-5 kit | Zymo | R1013 | |
Software, algorithm | GraphPad Prism | Dotmatics | Prism 10, version 10.2.2 (341) | |
Software, algorithm | Chimera | Pettersen et al., 2004 | X-1.6.1 | |
Gene (Homo sapiens) | TRMT1 | GenBank | Gene ID: 55621 | |
Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-FLAG | Dewe et al., 2017 | Fu Lab plasmid, mammalian expression vector for wild-type TRMT1 fused to FLAG | |
Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-GFP | Dewe et al., 2017 | Fu Lab plasmid, mammalian expression vector for wild-type TRMT1 fused to GFP | |
Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-FLAG-Q530N | This paper | Fu Lab plasmid, mammalian expression vector for TRMT1-Q530N variant fused to FLAG | |
Recombinant DNA reagent (plasmid) | pcDNA31.-TRMT1-FLAG-N-term | This paper | Fu Lab plasmid, mammalian expression vector for N-terminal TRMT1 fragment fused to FLAG | |
Recombinant DNA reagent (plasmid) | pcDNA31.-TRMT1-FLAG-C-term | This paper | Fu Lab plasmid, mammalian expression vector for C-terminal TRMT1 fragment fused to FLAG | |
Recombinant DNA reagent (plasmid) | pLenti-CMV-GFP-Blast | Addgene | Addgene #17445 | |
Recombinant DNA reagent (plasmid) | pLenti-CMV-TRMT1-FLAG | This paper | Fu Lab plasmid, lentiviral expression vector for wild-type TRMT1 fused to FLAG | |
Recombinant DNA reagent (plasmid) | pLenti-CMV-TRMT1-FLAG-Q530N | This paper | Fu Lab plasmid, lentiviral expression vector for TRMT1-Q530N fused to FLAG | |
Recombinant DNA reagent (plasmid) | psPAX2 | Addgene | Addgene # 12260 | |
Recombinant DNA reagent (plasmid) | pMD2.G | Addgene | Addgene #12259 | |
Other | MagSTREP ‘type3’ XT beads, 5% suspension | IBA Lifesciences | 2-4090-002 | For protein purification |
Other | DYKDDDDK-Tag Monoclonal Antibody Magnetic Microbead | Syd Labs | PA004830 | For protein purification |
Antibody | anti-TRMT1 aa 201–229 (mouse monoclonal) | Santa Cruz Biotechnologies | G3, sc-373687 | Western blot (1:1,000) |
Antibody | anti-TRMT1 aa 609–659 (rabbit polyclonal) | Bethyl | A304-205A | Western blot (1:500) |
Antibody | IBA LifeSciences StrepMAB-Classic (mouse monoclonal) | Fisher Scientific | NC9261069 | Western blot (1:1000) |
Antibody | ANTI-FLAG M2 (Mouse monoclonal) | Sigma | F3165 | Western blot (1:5000) |
Antibody | anti-SARS-CoV-2 nucleoprotein N protein (Rabbit polyclonal) | Sino Biological | 40068-RP01 | Western blot (1:1000) |
Antibody | anti-actin C4 (Mouse monoclonal) | EMD Millipore | MAB1501 | Western blot (1:1,000) |
Antibody | IRDye 800CW anti-mouse IgG (goat polyclonal) | Fisher Scientific | 925–32210 | Western blot secondary (1:10,000) |
Antibody | IRDye 680RD anti-Mouse IgG (Goat polyclonal) | Li-COR | 925–68070 | Western blot secondary (1:10,000) |
Other | Odyssey Imager instrument | Li-Cor | CLx | For imaging infrared dye immunoblots. |
Software, algorithm | Image Studio | Li-Cor | Version 5.2 | |
Software, algorithm | Fiji (Fiji is just ImageJ) | Schindelin et al., 2012 | Release 2.15.1 | |
Recombinant DNA reagent (plasmid) | RRL.sin.cPPT.SFFV/ Ace2.WPRE (MT136) | Rebendenne et al., 2021 | Addgene 145842 | |
Antibody | anti-ACE2 Antibody (Goat polyclonal) | R&D systems | AF933 | Western blot (1:200) |
Sequence-based reagent | SARS_For | This paper | QRT-PCR | ACAGGTACGTTAATAGTTAATAGCGT |
Sequence-based reagent | SARS_Rev | This paper | QRT-PCR | ATATTGCAGCAGTACGCACACA |
Sequence-based reagent | GAPDH_For | This paper | QRT-PCR | GCTCACCGGCATGGCCTTTCGCGT |
Sequence-based reagent | GAPDH_Rev | This paper | QRT-PCR | TGGAGGAGTGGGTGTCGCTGTTGA |