1. Cell Biology
  2. Immunology and Inflammation

Succinate mediates inflammation-induced adrenocortical dysfunction

  1. Ivona Mateska  Is a corresponding author
  2. Anke Witt
  3. Eman Hagag
  4. Anupam Sinha
  5. Canelif Yilmaz
  6. Evangelia Thanou
  7. Na Sun
  8. Ourania Kolliniati
  9. Maria Patschin
  10. Heba Abdelmegeed
  11. Holger Henneicke
  12. Waldemar Kanczkowski
  13. Ben Wielockx
  14. Christos Tsatsanis
  15. Andreas Dahl
  16. Axel Karl Walch
  17. Ka Wan Li
  18. Mirko Peitzsch
  19. Triantafyllos Chavakis
  20. Vasileia Ismini Alexaki  Is a corresponding author
  1. Institute of Clinical Chemistry and Laboratory Medicine, University Hospital, Technische Universität Dresden, Germany
  2. Center of Neurogenomics and Cognitive Research (CNCR), Department of Molecular and 10 Cellular Neurobiology, Vrije Universiteit, Netherlands
  3. Research Unit Analytical Pathology, German Research Center for Environmental Health, Helmholtz Zentrum München, Germany
  4. Department of Clinical Chemistry, Medical School, University of Crete, Greece
  5. Department of Medicine III & Center for Healthy Ageing, Technische Universität Dresden, Germany
  6. Center for Regenerative Therapies, TU Dresden, Technische Universität Dresden, Germany
  7. DRESDEN-concept Genome Center, Center for Molecular and Cellular Bioengineering, Technische Universität Dresden, Germany
https://doi.org/10.7554/eLife.83064
Share this article
Cite this article
  1. Ivona Mateska
  2. Anke Witt
  3. Eman Hagag
  4. Anupam Sinha
  5. Canelif Yilmaz
  6. Evangelia Thanou
  7. Na Sun
  8. Ourania Kolliniati
  9. Maria Patschin
  10. Heba Abdelmegeed
  11. Holger Henneicke
  12. Waldemar Kanczkowski
  13. Ben Wielockx
  14. Christos Tsatsanis
  15. Andreas Dahl
  16. Axel Karl Walch
  17. Ka Wan Li
  18. Mirko Peitzsch
  19. Triantafyllos Chavakis
  20. Vasileia Ismini Alexaki
(2023)
Succinate mediates inflammation-induced adrenocortical dysfunction
eLife 12:e83064.
https://doi.org/10.7554/eLife.83064
  2. Download BibTeX
  3. Download .RIS
9 figures, 6 tables and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
LPS-induced inflammation changes the transcriptional and proteomic profile of the adrenal cortex.

(A) Volcano plot showing differentially expressed genes in the microdissected adrenal gland cortex of mice treated for 6 hr with PBS or LPS. (B) Gene set enrichment analysis (GSEA) for immune pathways in the adrenal cortex of LPS versus PBS mice. (C) GSEA for proteins associated with the innate immune response in CD31-CD45- adrenocortical cells of mice treated for 24 hr with PBS or LPS. (D) RNA-Seq-based GSEA for carbohydrate metabolism in the adrenal cortex of LPS versus PBS mice. (E) GSEA for proteins associated with carbohydrate metabolism in CD31-CD45- adrenocortical cells of LPS versus PBS mice. NES: normalized enrichment score. (A,B,D) n=3 mice per group, (C,E) n=6 mice per group, padj <0.05 was used as a cut-off for significance.

Figure 1—source data 1

LPS-induced inflammation changes the transcriptional and proteomic profile of the adrenal cortex.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig1-data1-v2.zip
Figure 1—figure supplement 1
Download asset Open asset
Efficiency of CD31-CD45-, immune (CD45+), and endothelial (CD31+) cell sorting.

mRNA expression of Star (A), Cd31 (B), and Cd45 (C) in sorted CD31-CD45-, CD45+, and CD31+ cell populations from adrenal glands of mice 6 hr post-injection of PBS or LPS (n=6 mice per group). mRNA expression of tyrosine hydroxylase (Th) (D) and phenylethanolamine N-methyltransferase (Pnmt) (E) in medulla, cortex, and CD31-CD45- cells (ACC) (n=4 mice per group). Data are presented as mean ± s.d. Statistical analysis was done with two-tailed Mann-Whitney U-test. *p<0.05, **p<0.01.

Figure 1—figure supplement 1—source data 1

Efficiency of CD31-CD45-, immune (CD45+), and endothelial (CD31+) cell sorting.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig1-figsupp1-data1-v2.zip
Figure 1—figure supplement 2
Download asset Open asset
Inflammation-associated changes in the steroidogenic pathway.

(A–E) mRNA expression of steroidogenic enzymes (Star, Cyp11b1, Hsd3b2, Cyp21a1, and Cyp11a1) in adrenocortical cells of mice treated for 6 hr with PBS or LPS (n=6–8 mice per group, shown one from two experiments). (F) Representative immunofluorescence images of adrenal gland sections from PBS and LPS mice stained for steroidogenic factor 1 (SF-1) (magenta) and DAPI (blue). Scale bar, 300 μm. Quantification of the mean fluorescence intensity of SF-1 staining in the adrenal cortex (excluding the outer capsule region) (n=6 mice per group). Data are presented as mean ±s.d. Statistical analysis was done with two-tailed Mann-Whitney test. *p<0.05, **p<0.01.

Figure 1—figure supplement 2—source data 1

Inflammation-associated changes in the steroidogenic pathway.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig1-figsupp2-data1-v2.zip
Figure 2 with 1 supplement
Download asset Open asset
Systemic inflammation disrupts the TCA cycle in the adrenal cortex.

(A,B) Transcriptome analysis in the microdissected adrenal gland cortex of mice treated for 6 hr with PBS or LPS (n=3 mice per group). (A) Gene set enrichment analysis (GSEA) for TCA cycle genes. (B) Heatmap of differentially expressed TCA cycle genes (padj <0.05). (C) GSEA analysis for TCA cycle proteins in CD31-CD45- adrenocortical cells of mice treated for 24 hr with PBS or LPS (n=6 mice per group). (D,E) mRNA expression of Idh1, Idh2, Sdhb, and Sdhc in adrenocortical CD31-CD45- cells of mice treated for 6 hr with PBS or LPS (n=8 mice per group, shown one from two experiments). (F,G) Quantification of IDH and SDH activities in the adrenal cortex of mice treated for 24 hr with LPS or PBS (n=6 mice per group). Values are normalized to the total protein amount in the adrenal cortex. (H,I) Immunofluorescence images of the adrenal gland, stained for IDH2 (red) or SDHB (red), SF-1 (magenta), Isolectin (staining endothelial cells, green), and DAPI (blue). Scale bar, 30 μm. (J–O) TCA cycle metabolites (isocitrate, α-ketoglutarate, succinate, fumarate) were measured by LC-MS/MS in adrenal glands of mice 24 hr after injection with PBS or LPS (n=4 mice per group, shown one from two experiments). (P,Q) MALDI-MSI for isocitrate and succinate in the adrenal cortex of mice treated for 24 hr with PBS or LPS (n=3 mice per group). Representative images and quantifications are shown. Scale bar, 500 μm. Data in (D–G,J–Q) are presented as mean ±s.d. Statistical analysis was done with two-tailed Mann-Whitney test (D–G) or one-tailed Mann-Whitney test (J–Q). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. NES: normalized enrichment score.

Figure 2—source data 1

Systemic inflammation disrupts the TCA cycle in the adrenal cortex.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig2-data1-v2.zip
Figure 2—figure supplement 1
Download asset Open asset
Expression of TCA cycle genes in endothelial and immune cells of adrenal glands of LPS-treated mice.

mRNA expression of Idh1, Idh2, Sdhb, and Sdhc in endothelial (CD31+) (A) and immune (CD45+) cells (B) sorted from adrenal glands of mice treated for 6 hr with PBS or LPS (n=6–8 mice per group, shown one from two experiments). Data are presented as mean ± s.d. Statistical analysis was done with two-tailed Mann-Whitney test. *p<0.05, **p<0.01, ***p<0.001.

Figure 2—figure supplement 1—source data 1

Expression of TCA cycle genes in endothelial and immune cells of adrenal glands of LPS-treated mice.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig2-figsupp1-data1-v2.zip
Figure 3
Download asset Open asset
Oxidative phosphorylation is reduced and oxidative stress is increased in the adrenal cortex of LPS-treated mice.

(A) Gene set enrichment analysis (GSEA) for oxidative phosphorylation-related genes in the adrenal cortex of mice treated for 6 hr with PBS or LPS (n=3 mice per group). (B) GSEA for oxidative phosphorylation-associated proteins in CD31-CD45- adrenocortical cells of mice treated for 24 hr with PBS or LPS (n=6 mice per group). (C) Heatmap of differentially expressed genes related to oxidative phosphorylation (padj <0.05). (D) Measurement of ATP in adrenal glands of mice treated for 24 hr with PBS or LPS (n=10–11 mice per group, pooled from two experiments). (E) Measurement of mitochondrial membrane potential by TMRE staining and mitochondrial load by Mitotracker Green FM in CD31-CD45-adrenocortical cells of PBS or LPS mice. Data are presented as ratio of the median fluorescence intensities of TMRE to Mitotracker Green FM (n=6 mice per group). (F) Representative immunofluorescence images of adrenal gland sections from PBS- and LPS-treated mice (24 hr post-injection), stained for 4-hydroxynonenal (4-HNE) (magenta) and DAPI (blue). Scale bar, 300 μm. Quantification of the mean fluorescence intensity of 4-HNE staining in the adrenal cortex of PBS- or LPS-treated mice (n=6 mice per group). (G) NADPH measurement by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in adrenal glands of mice treated with PBS or LPS for 24 hr (n=8 mice per group). Data are given as observed peak area intensities of NADPH. (H) GSEA for glutathione metabolism of RNA-Seq data in the adrenal cortex of LPS versus PBS mice (n=3 mice per group). Data in (D–G) present mean ± s.d. Statistical analysis was done with two-tailed Mann-Whitney test. *p<0.05, **p<0.01. NES: normalized enrichment score.

Figure 3—source data 1

Oxidative phosphorylation is reduced and oxidative stress is increased in the adrenal cortex of LPS-treated mice.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig3-data1-v2.zip
Figure 4
Download asset Open asset
Increased succinate levels impair mitochondrial function in adrenocortical cells.

(A,B) Succinate and fumarate levels were measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in adrenal gland explants (A) and NCI-H295R cells (B) treated with dimethyl malonate (DMM) or diethyl succinate (DES) for 24 hr (n=5 for (A) and n=4 for (B)). (C) Oxygen consumption rate (OCR) measurement with Seahorse technology in NCI-H295R cells treated with DMM or DES for 24 hr (n=6). (D) Measurement of ATP/ADP ratio in NCI-H295R cells treated with DMM or DES for 24 hr (n=4–12). (E,F) TMRE and Mitotracker Green FM staining assessed by flow cytometry in NCI-H295R cells treated with DES for 4 hr, MFI is shown (n=7 for (E) and n=4, one from two experiments for (F)). (G) ROS measurement in NCI-H295R cells treated with DMM or DES for 2 hr (n=10–12). (H) Measurement of NADPH/NADP+ ratio in NCI-H295R cells treated with DMM for 24 hr (n=3–4). (I) Isocitrate levels measured by LC-MS/MS in NCI-H295R cells treated for 24 hr with AG221 or DMSO (n=6). (J) OCR measurement in NCI-H295R cells treated for 24 hr with AG221 or DMSO (n=10). (K) TMRE staining and flow cytometry in NCI-H295R cells treated for 4 hr with AG221 or DMSO, MFI is shown (n=7). Data in (A–B,D–I,K) are presented as mean ± s.d. Data in (C,J) are presented as mean ± s.e.m. Statistical analysis was done with one-way ANOVA (A, G) or two-tailed (B,D,E,F,I,K) or one-tailed (H) Mann-Whitney test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Figure 4—source data 1

Increased succinate levels impair mitochondrial function in adrenocortical cells.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig4-data1-v2.zip
Figure 5 with 4 supplements
Download asset Open asset
Disruption of SDH function impairs glucocorticoid production.

(A–E) Primary adrenocortical cells (A,B) and adrenal explants (C–E) were treated for 24 hr with dimethyl malonate (DMM) or diethyl succinate (DES) and for another 45 min with adrenocorticotropic hormone (ACTH) (10 ng/ml or 100 ng/ml, respectively) (n=5–6). (F–H) Primary adrenocortical cells were transfected with siSdhb or non-targeting siRNA (siCtrl) and 24 hr post-transfection they were treated for 45 min with ACTH (n=7–8). (I,J) NCI-H295R cells were treated for 24 hr with FCCP (I) or oligomycin (OM) (J) and for another 30 min with Forskolin (Fsk) (n=6). (K–M) Primary adrenocortical cells were treated for 24 hr with oligomycin (OM) and for another 45 min with ACTH (n=6). (N) ROS measurement in NCI-H295R cells pre-treated for 15 min with Trolox or control solution (DMSO) and then treated for 2 hr with DMM (n=3). (O,P) NCI-H295R cells pre-treated for 15 min with Trolox or DMSO were treated or not for 24 hr with DMM and Forskolin (n=6). (Q,R) Cyp11a1 and Cyp11b1 expression in primary adrenocortical cells treated for 24 hr with DMM or DES and for 45 min with ACTH (n=5–6). (S) Adrenal gland explants were treated for 24 hr with LPS and for 45 min with ACTH (n=4–5). Measurements of steroid hormones in (A–M,O,P,S) were performed in supernatants of primary adrenocortical cell cultures or adrenal gland explants by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data are presented as mean ± s.d. Statistical analysis was done with one-way ANOVA (A–E, I–M,S), Wilcoxon (F,G,H), one-tailed Mann-Whitney (N), or two-tailed Mann-Whitney test (O–R). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. BLD = below level of detection.

Figure 5—source data 1

Disruption of SDH function impairs glucocorticoid production.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig5-data1-v2.zip
Figure 5—figure supplement 1
Download asset Open asset
High succinate levels impair glucocorticoid production in adrenocortical cells.

(A,B) NCI-H295R cells were treated for 24 hr with dimethyl malonate (DMM) or diethyl succinate (DES) and for another 24 hr with Forskolin (Fsk) (n=6–12). (C) NCI-H295R cells were transfected with siSDHB or control siRNA (siCtrl) and 24 hr post-transfection they were treated for 24 hr with Forskolin (n=4). (D–F) NCI-H295R cells were treated for 24 hr with the indicated concentrations of DES and for another 24 hr with Forskolin (n=4). (G) Primary adrenocortical cells were transfected with siSdhb or non-targeting siRNA (siCtrl) and 24 hr post-transfection they were treated for 45 min with adrenocorticotropic hormone (ACTH) (n=8). (H) Adrenal gland explants were treated for 24 hr with LPS and for 45 min with ACTH (n=4–5). Measurements for indicated steroid hormones were performed in cell culture or adrenal explant supernatants by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data are presented as mean ± s.d. Statistical analysis was done with one-way ANOVA (A–C); two-way ANOVA (D–F), or two-tailed Mann-Whitney test (G,H). **p<0.01, ***p<0.001, ****p<0.0001. BLD = below level of detection.

Figure 5—figure supplement 1—source data 1

High succinate levels impair glucocorticoid production in adrenocortical cells.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig5-figsupp1-data1-v2.zip
Figure 5—figure supplement 2
Download asset Open asset
SiRNA silencing efficiencies.

(A) Western blot analysis for SDHB in NCI-H295R cells transfected with 10, 30, or 50 nM siSDHB or siCtrl (24 hr post-transfection). α-TUBULIN was used as loading control. (B,C) mRNA expression of Sdhb and Idh2 in primary adrenocortical cells transfected for 24 hr with 10, 30, or 50 nM siSdhb, siIdh2, or siCtrl (n=3). (D) Dnmt1 expression in primary adrenocortical cells transfected for 24 hr with 30 nM siDnmt1 or siCtrl (n=5–6). (E) DNMT1 expression in NCI-H295R cells transfected for 48 hr with 30 nM siDNMT1 or siCtrl (n=2). (F) Western blot analysis for DNMT1 in NCI-H295R cells transfected with 30 nM siDNMT1 or siCtrl (48 hr post-transfection). β-Actin was used as loading control. Data in (B–E) are presented as mean ± s.d. Statistical analysis was done with two-way ANOVA (B,C) or one-way ANOVA (D). *p<0.05, **p<0.01, ****p<0.0001. Red boxes mark the concentrations with most efficient knock-down, which were chosen for further experiments. Full unedited blots for (A) and (F) are available in Figure 5—figure supplement 2—source data 1.

Figure 5—figure supplement 2—source data 1

SiRNA silencing efficiencies.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig5-figsupp2-data1-v2.zip
Figure 5—figure supplement 3
Download asset Open asset
Disruption of IDH function does not affect glucocorticoid production.

(A,B) Primary adrenocortical cells were treated for 24 hr with AG221 or DMSO and for another 45 min with adrenocorticotropic hormone (ACTH) (n=2–6). (C,D) Adrenal gland explants were treated for 24 hr with AG221 or DMSO and for another 45 min with ACTH (n=2–4). (E,F) NCI-H295R cells were treated for 24 hr with AG221 or DMSO and for another 24 hr with Forskolin (n=4–6). (G,H) Primary adrenocortical cells were transfected with siIdh2 or siCtrl and 24 hr post-transfection they were treated for 45 min with ACTH (n=2–7). Measurements of steroid hormones were performed in supernatants of primary adrenocortical cell cultures, adrenal gland explants, or NCI-H295R cells by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data are presented as mean ± s.d. Statistical analysis was done with one-way ANOVA. ****p<0.0001. BLD = below level of detection.

Figure 5—figure supplement 3—source data 1

Disruption of IDH function does not affect glucocorticoid production.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig5-figsupp3-data1-v2.zip
Figure 5—figure supplement 4
Download asset Open asset
Itaconate does not affect SDH activity or steroidogenesis in adrenocortical cells.

(A) mRNA expression of Acod1 in CD31-/CD45- and CD45+ cells sorted from adrenal cortex of mice treated for 6 hr with PBS or LPS (n=4–8 mice per group, shown one from two experiments). (B,C) Itaconate levels in CD31-/CD45- (B) and CD31+/CD45+ cells (C) sorted from adrenal glands of mice treated for 24 hr with PBS or LPS (n=8 mice per group, shown one from two experiments). (D–G) Itaconate, succinate, and fumarate levels and succinate/fumarate ratio in lysates of primary adrenocortical cells treated for 24 hr with 4-octyl itaconate (4-OI) (n=4). (H,I) Corticosterone and 11-deoxycorticosterone levels in the supernatant of primary adrenocortical cells treated for 24 hr with 4-OI (n=4). (J) Quantification of SDH activity in the adrenal cortex of Acod1-KO and wild-type mice treated for 16 hr with LPS (n=5–6 mice per group). Values are normalized to the total protein amount in the adrenal cortex. Data are presented as mean ± s.d. Statistical analysis was done with two-tailed Mann-Whitney test. *p<0.05, ***p<0.001.

Figure 5—figure supplement 4—source data 1

Itaconate does not affect SDH activity or steroidogenesis in adrenocortical cells.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig5-figsupp4-data1-v2.zip
Figure 6
Download asset Open asset
IL-1β reduces SDHB expression and adrenocortical steroidogenesis in a DNA methyltransferase 1 (DNMT1)-dependent manner.

(A) Gene set enrichment analysis (GSEA) for genes related to positive regulation of IL-1β secretion in the adrenal cortex of mice treated for 6 hr with PBS or LPS (n=3 mice per group). (B) Il1r1 expression in CD31-CD45- adrenocortical cells of mice 6 hr post-injection with PBS or LPS (n=6 mice per group). (C) GSEA for proteins related to IL-1β signaling in CD31-CD45- adrenocortical cells of mice treated for 24 hr with PBS or LPS (n=6 mice per group). (D) SDHB expression in NCI-H295R cells treated for 2 hr with IL-1β, IL-6, or TNFα (n=5–6). (E) Measurement of ATP/ADP ratio in NCI-H295R cells treated for 24 hr with IL-1β (n=5–6). (F–H) Primary adrenocortical cells were treated for 6 hr with IL-1β and for another 45 min with adrenocorticotropic hormone (ACTH) (10 ng/ml) (n=11–12). Steroid hormones were measured in the culture supernatant by liquid chromatography-tandem mass spectrometry (LC-MS/MS). (I) Western blot analysis for DNMT1 in CD31-CD45- adrenocortical cells 24 hr after injection of PBS (P) or LPS (L) (n=4 mice per group), α-TUBULIN was used as loading control. The asterisk (*) depicts an unspecific band. Quantification of the western blot is shown as relative intensity of DNMT1 to α-TUBULIN. (J) NCI-H295R cells were treated for 2 hr with IL-1β; representative gel electrophoresis images of bisulfite converted and non-treated DNA (M – methylated, U – unmethylated) are shown. The ratio of methylated to unmethylated SDHB promoter was assayed after bisulfite conversion (n=4). (K) NCI-H295R cells were transfected with siDNMT1 or siCtrl and 24 hr post-transfection they were treated for 2 hr with IL-1β. The ratio of methylated to unmethylated SDHB promoter was quantified (n=2–3). (L) Sdhb expression in primary adrenocortical cells transfected with siDnmt1 or siCtrl and 24 hr post-transfection treated for 6 hr with IL-1β (n=8). (M) Primary adrenocortical cells were transfected with siDnmt1 or siCtrl and 6 hr post-transfection they were treated for 18 hr with IL-1β (n=4). Succinate and fumarate were measured by LC-MS/MS. (N) Oxygen consumption rate (OCR) measurement in NCI-H295R cells transfected with siDNMT1 or siCtrl and 24 hr post-transfection treated for 24 hr with IL-1β (n=8). (O–Q) Primary adrenocortical cells were transfected with siDnmt1 or siCtrl, 6 hr post-transfection they were treated for 18 hr with IL-1β and subsequently they were stimulated for 45 min with ACTH (n=7–9). Steroid hormones were measured in the cell culture supernatant by LC-MS/MS. (R) Mice were simultaneously injected with Raleukin or control solution and LPS and 24 hr later SDH activity was measured in isolated adrenal cortices (n=3 mice per group). (S–T) Mice were treated with Raleukin or control solution together with LPS and 24 hr post-injection succinate and fumarate levels were determined in the adrenal glands (n=7 mice per group). (U) Mice were treated with Raleukin or control solution together with LPS and 6 hr later corticosterone plasma levels were determined by LC-MS/MS (n=7 mice per group). Data in (B,D–L,R–U) are presented as mean ± s.d. Statistical analysis was done with Mann-Whitney (B,D,I,J,N,R–U), unpaired t-test (E,K), paired t-test, (M) and Wilcoxon test (F–H,L,O–Q). *p<0.05, **p<0.01. NES: normalized enrichment score. Full unedited blots and gels are available in Figure 6—source data 1 (I,J).

Figure 6—source data 1

IL-1β reduces SDHB expression and adrenocortical steroidogenesis in a DNA methyltransferase 1 (DNMT1)-dependent manner.

https://cdn.elifesciences.org/articles/83064/elife-83064-fig6-data1-v2.zip
Figure 7
Download asset Open asset
Illustration of the regulation of adrenocortical steroidogenesis by inflammation.

IL-1β reduces SDHB expression through upregulation of DNA methyltransferase 1 (DNMT1) and methylation of the SDHB promoter. Consequently, increased succinate levels impair oxidative phosphorylation and increase ROS production, leading to reduced steroidogenesis.

Author response image 1
Download asset Open asset
LPS increases the succinate/fumarate ratio at 24 but not 6 h.

Mice were i.p. injected with 1 mg/kg LPS and 6 h (A) and 24 h (B) post-injection succinate and fumarate levels were determined by LC-MS/MS in the adrenal gland. n=8-10; data are presented as mean ± s.e.m. Statistical analysis was done with two-tailed Mann-Whitney test. *p < 0.05.

Author response image 2
Download asset Open asset
Five mg/kg LPS downregulate Sdhb, Idh1 and Idh2 expression and increase succinate and isocitrate levels in the adrenal gland of mice.

Sdhb, Idh1 and Idh2 expression (A) and succinate and isocitrate levels (B) were assessed in the adrenal gland of mice treated with 5 mg/kg LPS for 4 h (A) and 24 h (B). n=5; data are presented as mean ± s.d. Statistical analysis was done with two-tailed Mann-Whitney test. *p < 0.05, **p < 0.01.

Tables

Table 1
Cellular metabolic pathways transcriptionally regulated by inflammation in the adrenal cortex.

The pathway analysis of differentially expressed genes was done with the software package EGSEA and queried against the KEGG pathways repository. Pathways with p<0.05 are shown.

IDMetabolic pathwayNumber of expressed genesp-Valuepadjavg.logfcDirection
mmu00190Oxidative phosphorylation132/1348.32E-157.32E-130.613034377Down
mmu00280Valine, leucine, and isoleucine degradation55/561.16E-050.0011191540.725758563Down
mmu00511Other glycan degradation18/183.82E-050.0011191540.29921956Down
mmu00980Metabolism of xenobiotics by cytochrome P45065/650.0002824560.0062140290.650304677Down
mmu00350Tyrosine metabolism38/390.0017547880.0308842680.305935415Down
mmu00640Propanoate metabolism31/310.0021514470.0315545630.886410728Down
mmu00020Citrate cycle (TCA cycle)32/320.0030918280.0346364640.21912487Down
mmu01200Carbon metabolism118/1180.0036857490.0346364640.715139933Down
mmu00471D-Glutamine and D-glutamate metabolism3/30.0039808260.0346364640.338725016Up
mmu00300Lysine biosynthesis2/20.0045188070.0346364640.156233777Down
mmu00630Glyoxylate and dicarboxylate metabolism29/290.0060791260.0346364640.886410728Down
mmu00071Fatty acid degradation49/490.0061246730.0346364640.401441917Down
mmu012102-Oxocarboxylic acid metabolism19/190.0062975390.0346364640.942661129Down
mmu00920Sulfur metabolism11/110.0062975390.0346364640.601864913Down
mmu00480Glutathione metabolism58/590.0062975390.0346364640.550257753Down
mmu00510N-Glycan biosynthesis49/490.0062975390.0346364640.254426968Down
mmu00450Selenocompound metabolism17/170.0091155270.0471862590.329118527Up
mmu00514Other types of O-glycan biosynthesis22/220.0106149580.0506933940.204924928Up
mmu00440Phosphonate and phosphinate metabolism6/60.0109451650.0506933940.291510253Up
mmu00120Primary bile acid biosynthesis16/160.011934220.0525105662.713591551Down
mmu00565Ether lipid metabolism44/440.0167118120.0617248140.433837026Down
mmu00520Amino sugar and nucleotide sugar metabolism49/490.0182126610.0617248140.652646241Down
mmu00790Folate biosynthesis14/140.018215690.0617248140.420000237Down
mmu00230Purine metabolism174/1780.0187933870.0617248140.830115541Down
mmu00603Glycosphingolipid biosynthesis – globo series16/160.0198320340.0617248140.534287429Up
mmu00534Glycosaminoglycan biosynthesis – heparan sulfate/heparin24/240.0204915240.0617248140.471378176Up
mmu00270Cysteine and methionine metabolism46/480.0209595070.0617248140.601864913Down
mmu01100Metabolic pathways1303/13150.0224190020.0617248140.683947211Down
mmu00531Glycosaminoglycan degradation21/210.0231396860.0617248140.911753864Down
mmu00604Glycosphingolipid biosynthesis – ganglio series15/150.0232687160.0617248140.457285673Down
mmu00250Alanine, aspartate, and glutamate metabolism36/370.0236855190.0617248140.942661129Down
mmu00240Pyrimidine metabolism101/1040.0242358870.0617248140.308135641Up
mmu00130Ubiquinone and other terpenoid-quinone biosynthesis11/110.0246305840.0617248140.40991964Down
mmu00330Arginine and proline metabolism49/500.0250887920.0617248140.479554867Down
mmu00564Glycerophospholipid metabolism94/940.0254488590.0617248140.498146256Down
mmu00910Nitrogen metabolism17/170.0257826010.0617248141.765582115Up
mmu00982Drug metabolism – cytochrome P45067/670.0272013040.0617248140.620562175Down
mmu00785Lipoic acid metabolism3/30.0275075530.0617248140.133403173Down
mmu00051Fructose and mannose metabolism35/350.0296798890.0617248140.652646241Down
mmu00561Glycerolipid metabolism59/590.0304687730.0617248140.4155946Down
mmu00512Mucin type O-glycan biosynthesis28/280.0305403270.0617248140.472458211Up
mmu00052Galactose metabolism32/320.0313765590.0617248140.42838689Down
mmu01230Biosynthesis of amino acids78/780.0318009040.0617248140.942661129Down
mmu00533Glycosaminoglycan biosynthesis – keratan sulfate14/140.0318721090.0617248140.27544313Down
mmu00900Terpenoid backbone biosynthesis22/230.0322323210.0617248140.320850492Up
mmu00730Thiamine metabolism15/150.0322652440.0617248140.323024942Down
mmu00500Starch and sucrose metabolism33/330.0334135450.0621780730.452533726Up
mmu00770Pantothenate and CoA biosynthesis18/180.0339153120.0621780730.307590054Down
mmu00062Fatty acid elongation27/270.0357038540.0622007730.536297353Down
mmu00592Alpha-linolenic acid metabolism25/250.0358611140.0622007730.568488547Down
mmu00562Inositol phosphate metabolism70/700.0370605970.0622007730.197317479Up
mmu00760Nicotinate and nicotinamide metabolism34/350.0377777030.0622007730.44361797Down
mmu00740Riboflavin metabolism8/80.0385316070.0622007730.336638606Down
mmu00670One carbon pool by folate19/190.0398070010.0622007730.293141874Up
mmu00310Lysine degradation57/590.0402212840.0622007730.409052131Up
mmu00010Glycolysis/gluconeogenesis66/660.0403725130.0622007730.4474754Down
mmu00053Ascorbate and aldarate metabolism27/270.0405353030.0622007730.319047565Down
mmu00030Pentose phosphate pathway32/320.0409959640.0622007730.316347941Down
Table 2
Cellular metabolic pathways regulated on protein level by inflammation in adrenocortical cells.

The pathway analysis of differentially expressed proteins was done with the software package EGSEA and queried against the KEGG pathways repository. Pathways with p<0.05 are shown.

IDMetabolic pathwayNumber of detected proteinsp-Valuepadjavg.logfcDirection
mmu00534Glycosaminoglycan biosynthesis – heparan sulfate/heparin4/241.50E-071.29E-050.13Up
mmu00280Valine, leucine, and isoleucine degradation37/575.20E-072.23E-050.01Down
mmu00983Drug metabolism – other enzymes25/923.80E-050.0008561420.02Down
mmu00562Inositol phosphate metabolism19/725.89E-050.0008561420.03Up
mmu00260Glycine, serine, and threonine metabolism19/406.89E-050.0008561420.03Down
mmu00240Pyrimidine metabolism25/586.98E-050.0008561420.04Up
mmu00982Drug metabolism – cytochrome P45016/717.76E-050.0008561420.02Down
mmu00230Purine metabolism44/1337.96E-050.0008561420.04Up
mmu00790Folate biosynthesis9/269.75E-050.0009314520.09Up
mmu01100Metabolic pathways593/16080.0001346940.0011511760.03Down
mmu00190Oxidative phosphorylation70/1350.0001603680.0011511760.02Down
mmu00980Metabolism of xenobiotics by cytochrome P45019/730.0001759970.0011511760.02Down
mmu01240Biosynthesis of cofactors74/1540.0001781130.0011511760.04Down
mmu00730Thiamine metabolism5/150.0001874010.0011511760.02Down
mmu00020Citrate cycle (TCA cycle)30/320.000201770.0011568120.01Down
mmu01200Carbon metabolism81/1210.0004048050.0021758260.02Down
mmu00760Nicotinate and nicotinamide metabolism11/410.0004596490.0023252830.04Up
mmu00860Porphyrin and chlorophyll metabolism19/430.0005492790.0026243330.04Up
mmu00360Phenylalanine metabolism7/230.0007445910.0033702530.01Up
mmu00630Glyoxylate and dicarboxylate metabolism20/320.0007944080.0034159560.02Down
mmu00480Glutathione metabolism28/720.0010379940.0042508320.02Down
mmu00061Fatty acid biosynthesis12/190.001199340.0043234660.04Up
mmu00052Galactose metabolism17/320.0012120320.0043234660.02Down
mmu00350Tyrosine metabolism12/400.0012757640.0043234660.02Down
mmu00900Terpenoid backbone biosynthesis8/230.0012830460.0043234660.01Down
mmu00140Steroid hormone biosynthesis12/920.0013070940.0043234660.02Down
mmu00511Other glycan degradation11/180.0016200570.0051601820.03Down
mmu00520Amino sugar and nucleotide sugar metabolism29/510.0019225090.0059048480.02Down
mmu00040Pentose and glucuronate interconversions9/350.0022917560.0067962430.02Down
mmu00620Pyruvate metabolism34/440.0047411120.0134283660.02Down
mmu00524Neomycin, kanamycin, and gentamicin biosynthesis3/50.0048404580.0134283660.02Down
mmu00053Ascorbate and aldarate metabolism9/310.0052206650.0134290370.01Down
mmu00830Retinol metabolism8/970.0052794530.0134290370.01Down
mmu00531Glycosaminoglycan degradation10/210.0053091540.0134290370.02Down
mmu00450Selenocompound metabolism9/170.0069513550.0170804710.02Down
mmu00250Alanine, aspartate, and glutamate metabolism17/390.0079552630.0190042390.02Down
mmu01230Biosynthesis of amino acids45/790.0088731640.0206241110.02Down
mmu01212Fatty acid metabolism40/620.0093363250.0211295780.03Down
mmu00500Starch and sucrose metabolism14/340.0111700160.0246313160.02Down
mmu00514Other types of O-glycan biosynthesis15/430.0118764960.0253495570.04Up
mmu012102-Oxocarboxylic acid metabolism11/200.012276390.0253495570.01Down
mmu00650Butanoate metabolism13/280.0124041850.0253495570.01Down
mmu00670One carbon pool by folate9/190.0126747780.0253495570.05Down
mmu00310Lysine degradation20/640.014010520.0273841970.02Down
mmu00590Arachidonic acid metabolism9/860.0152531770.0291505170.01Down
mmu00770Pantothenate and CoA biosynthesis8/210.0166325220.0310955840.02Down
mmu00592Alpha-linolenic acid metabolism3/250.0178193710.0326056570.03Up
mmu00780Biotin metabolism3/30.0186505970.0334156530.01Down
mmu00640Propanoate metabolism25/310.0201827990.0351735640.02Down
mmu00290Valine, leucine, and isoleucine biosynthesis2/40.020534280.0351735640.02Down
mmu00920Sulfur metabolism7/110.0212063870.0351735640.02Down
mmu00062Fatty acid elongation15/190.0212677360.0351735640.02Down
mmu00604Glycosphingolipid biosynthesis – ganglio series5/150.0220657530.0358048070.02Down
mmu00563Glycosylphosphatidylinositol (GPI)-anchor biosynthesis8/260.0235535110.0361863070.04Down
mmu00750Vitamin B6 metabolism3/90.0235535110.0361863070.03Up
mmu00220Arginine biosynthesis7/200.0242454130.0361863070.02Down
mmu00270Cysteine and methionine metabolism29/530.0254102760.0361863070.03Up
mmu00051Fructose and mannose metabolism17/360.025519910.0361863070.04Down
mmu00071Fatty acid degradation30/520.0256670320.0361863070.02Down
mmu00330Arginine and proline metabolism23/540.0256670320.0361863070.02Down
mmu00561Glycerolipid metabolism23/620.0256670320.0361863070.03Down
mmu00010Glycolysis/gluconeogenesis40/670.0507288690.0681669170.02Down
mmu00030Pentose phosphate pathway17/330.0507288690.0681669170.03Down
mmu00410Beta-alanine metabolism19/320.0507288690.0681669170.01Down
Table 3
ROS pathways are transcriptionally upregulated in the adrenal cortex of LPS-treated mice.

The pathway analysis of differentially expressed genes was done with the software package EGSEA and queried against the GO gene sets repository. Pathways with padj. <0.05 are shown.

IDGene setNumber of expressed genesp-Valuepadjavg.logfcDirec tion
M13446GO Regulation of reactive oxygen species metabolic process271/2753.75E-081.26E-061.0100Up
M13580GO Positive regulation of reactive oxygen species metabolic process182/1862.33E-076.26E-061.0100Up
M16953GO Response to reactive oxygen species300/3170.0034221320.0090353750.8600Up
M16581GO Cellular response to reactive oxygen species173/1770.0025372970.0090353750.7600Up
M10618GO Negative regulation of response to reactive oxygen species24/240.00723840.0109421150.7100Up
M15379GO Regulation of reactive oxygen species biosynthetic process145/1485.90E-050.0007706090.7000Up
M10827GO Positive regulation of reactive oxygen species biosynthetic process120/1230.0004656060.004542610.7000Up
M15990GO Reactive oxygen species metabolic process163/1670.0089364650.0125689420.6700Up
M16764GO Regulation of response to reactive oxygen species43/430.0067532070.0104986280.6200Down
M16007GO Negative regulation of reactive oxygen species biosynthetic process23/230.0164343870.0202749960.6000Up
M12185GO Reactive oxygen species biosynthetic process32/330.0064832590.010242320.5700Down
M10894GO Negative regulation of reactive oxygen species metabolic process59/590.0065386540.0102876610.5500Up
Table 4
ROS-related protein expression is upregulated in the adrenal cortex of LPS-treated mice.

The pathway analysis of differentially expressed proteins was done with the software package EGSEA and queried against the GO gene sets repository. Pathways with padj. <0.05 are shown.

IDProtein setNumber of detected proteinsp-Valuepadjavg.logfcDirec-tion
M13446GO REGULATION OF REACTIVE OXYGEN SPECIES METABOLIC PROCESS62/2756.30E-060.000124010.03Up
M15379GO REGULATION OF REACTIVE OXYGEN SPECIES BIOSYNTHETIC PROCESS34/1489.43E-060.000143720.03Up
M13580GO POSITIVE REGULATION OF REACTIVE OXYGEN SPECIES METABOLIC PROCESS29/1861.11E-050.000157780.03Up
M10827GO POSITIVE REGULATION OF REACTIVE OXYGEN SPECIES BIOSYNTHETIC PROCESS20/1231.17E-050.000162030.03Up
M10894GO NEGATIVE REGULATION OF REACTIVE OXYGEN SPECIES METABOLIC PROCESS23/595.29E-050.000378560.05Down
M16007GO NEGATIVE REGULATION OF REACTIVE OXYGEN SPECIES BIOSYNTHETIC PROCESS12/230.000141260.000731670.07Up
M16581GO CELLULAR RESPONSE TO REACTIVE OXYGEN SPECIES50/1770.000153780.000775510.03Down
M15990GO REACTIVE OXYGEN SPECIES METABOLIC PROCESS35/1670.000374360.001504790.02Down
M16953GO RESPONSE TO REACTIVE OXYGEN SPECIES83/3170.000760760.002622740.03Up
M12185GO REACTIVE OXYGEN SPECIES BIOSYNTHETIC PROCESS9/330.001928440.005452140.02Down
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Mus musculus)C57BL/6JThe Jackson LaboratoryStock#000664 RRID:MGI:3028467
Gene (Mus musculus)C57BL/6NJ-Acod1em1(IMPC)J/JThe Jackson LaboratoryStrain #:029340 RRID:IMSR_JAX:029340
Cell line
(Homo sapiens)		NCI-H295RATCCCRL-2128
Chemical compound, drugUltrapure LPS, E. coli 0111:B4InVivoGentlrl-3pelpsFor in vivo
Chemical compound, drugRaleukinMedChemExpressArt. -Nr.: HY-108841
Chemical compound, drugUltrapure lipopolysaccharide from E. coli K12InVivoGentlrl-peklpsFor in vitro
Chemical compound, drugDMMSigma-Aldrich136441
Chemical compound, drugDESSigma-Aldrich112402
Chemical compound, drugFCCPAgilent TechnologiesSeahorse XFp Cell Mito Stress Test Kit 103010-100
Chemical Compound, drugOligomycinAgilent TechnologiesSeahorse XFp Cell Mito Stress Test Kit 103010-100
Chemical compound, drugEnasidenib (AG-221)SelleckchemS8205
Chemical compound, drug4-Octyl-itaconateCayman Chemical25374
Chemical compound, drugTroloxAbcamab120747
Peptide, recombinant protein (human)IL-1βPeproTech200-01B
Peptide, recombinant protein (mouse)IL-1βPeproTech211-11B
Peptide, recombinant protein (human)IL-6PeproTech200-06
Peptide, recombinant protein (human)TNFαPeproTech300-01A
Peptide, recombinant protein (mouse)ACTHSigma-AldrichA0298
Chemical compound, drugForskolinSigma-AldrichF3917
Transfected construct (human)siRNA to SDHB
(ON-TARGETplus siRNA SMARTpool)		Dharmacon/Thermo Fisher ScientificL-011773-02-0005
Transfected construct (human)siRNA to DNMT1
(ON-TARGETplus siRNA SMARTpool)		Dharmacon/Thermo Fisher ScientificL-004605-00-0005
Transfected construct (mouse)siRNA to Sdhb
(ON-TARGETplus siRNA SMARTpool)		Dharmacon/Thermo Fisher ScientificL-042339-01-0005
Transfected construct (mouse)siRNA to Dnmt1
(ON-TARGETplus siRNA SMARTpool)		Dharmacon/Thermo Fisher ScientificL-056796-01-0005
Sequence-based reagentSee Table 5This paperqPCR primersSee Table 5
AntibodyAnti-SDHB (Rabbit polyclonal)Sigma-AldrichHPA0028681:1000 for WB
1:300 for IF
Antibodyanti-IDH2 (Rabbit polyclonal)Sigma-AldrichHPA0078311:50 for IF
AntibodyAnti-DNMT1 (Rabbit monoclonal)Cell Signaling#50321:1000
AntibodyAnti-Tubulin (Mouse monoclonal)Sigma-AldrichT51861:3000
AntibodyAnti-β-Actin (Rabbit polyclonal)Cell Signaling#49671:1000
AntibodyAnti-SF-1 (Mouse monoclonal)TransGenic IncKO6101:100
Commercial assay or kitATP measurementAbcamab83355
Commercial assay or kitATP/ADP measurementSigma-AldrichMAK135
Commercial assay or kitDCFDA/H2DCFDA Cellular ROS Detection Assay KitAbcamab113851
Commercial assay or kitNADP/NADPH AssayAbcamab176724
Commercial assay or kitSDH activitySigma-AldrichMAK197
Commercial assay or kitIDH activityAbcamab102528
Commercial assay or kitSeahorse XFp Cell Mito Stress Test KitAgilent Technologies103010-100
Commercial assay or kitEZ DNA Methylation KitZymo ResearchD5001
Software, algorithmImageJ softwareImageJ (http://imagej.nih.gov/ij/)RRID:SCR_003070
Software, algorithmGraphPad Prism 7.04 softwareGraphPad Prism (https://graphpad.com)RRID:SCR_015807
Software, algorithmMorpheusBroad Institutehttps://software.broadinstitute.org/morpheus/
Software, algorithmSTAR AlignerDobin et al., 2013
Software, algorithmMouse Genome version GRCm38 (release M12 GENCODE)Anders et al., 2015
Software, algorithmDESeq2_1.8.1Anders and Huber, 2010
Software, algorithmggplot2_1.0.1Wickham, 2009
Software, algorithmGSEASubramanian et al., 2005
Software, algorithmEGSEAAlhamdoosh et al., 2017
Software, algorithmMass Spectrometry Downstream Analysis Pipeline (MS-DAP) (version beta 0.2.5.1) (https://github.com/ftwkoopmans/msdap)Hondius et al., 2021
Software, algorithmR/Bioconductor, ‘impute’ command running of ‘DEP’Zhang et al., 2018
OtherTMREThermo FisherT6692.5 μM for dissociated adrenocortical cells,
100 nM for NCI-H295R cells
OtherMitotracker GreenThermo FisherM75140.25 μM for dissociated adrenocortical cells,
100 nM for NCI-H295R cells
OtherDAPI stainRoche, Sigma-Aldrich102362760011:10,000
OtherLectin Esculentum DyLight488Vector LaboratoriesDL-11741:300
Other4-HydroxynonenalAbcamab485061:200
Table 5
Primer sequences.
Gene nameForward sequence (5’ → 3’)Reverse sequence (5’ → 3’)
Mouse 18S rRNAGTTCCGACCATAAACGATGCCTGGTGGTGCCCTTCCGTCAAT
Mouse Idh1GTGGTGGAGATGCAAGGAGATTGGTCATTGGTGGCATCACG
Mouse Idh2GATGGACGGTGACGAGATGACGGTCTGGTCACGGTTTGGA
Mouse SdhbGGACCTCAGCAAAGTCTCCAATGCAGATACTGTTGCTTGCC
Mouse SdhcGCTAAGGAGGAGATGGAGCGAGAGACCCCTCCACTCAAGG
Mouse StarCTGTCCACCACATTGACCTGCAGCTATGCAGTGGGAGACA
Mouse Cyp11b1TCACCATGTGCTGAAATCCTTCCAGGAAGAGAAGAGAGGGCAATGTGT
Mouse Hsd3b2GCGGCTGCTGCACAGGAATAAAGTCACCAGGCAGCTCCATCCA
Mouse Cyp21a1TGGGGATGCAAGATGTGGTGGTGGTCGGCCAGCAAAGTCCAC
Mouse Cyp11a1GGATGCTGGAGGAGATCGTGAAGTCTGGAGGCAGGTTGA
Mouse Cd31TGCAGGAGTCCTTCTCCACTACGGTTTGATTCCACTTTGC
Mouse Cd45CCAGTCATGCTACCACAACGTGGACATCTTTGAGGTCTGCC
Mouse ThAAGGGCCTCTATGCTACCCAGCCAGTCCGTTCCTTCAAGA
Mouse PnmtGCATCACATCACCACACTGCCGGACCTCGTAACCACCAAG
Mouse Acod1CTCCCACCGACATATGCTGCGCTTCCGATAGAGCTGTGA
Mouse Il1r1TGGAAGTCTTGTGTGCCCTTTCCGAAGAAGCTCACGTTGT
Mouse Dnmt1CTGGAAGAGGTAACAGCGGGCGTCCAAGTGAGTTTCCGGT
Human 18STGCCCTATCAACTTTCGATGGATGTGGTAGCCGTTTCTCA
Human SDHBCAAGGCTGGAGACAAACCTCAGGGTGCAAGCTAGAGTGTTG
Human DNMT1GGAGGGCTACCTGGCTAAAGCTGCCATTCCCACTCTACGG
Human methylated SDHB promoterAGTGGGTCCTCAGTGGATGTAGGCGATAGTTTGGTGGCAGA
Human unmethylated SDHB promoterCGCGATGTTCGACGGGATACTTCACACCCCGCAAATCTC

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/83064/elife-83064-mdarchecklist1-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Ivona Mateska
  2. Anke Witt
  3. Eman Hagag
  4. Anupam Sinha
  5. Canelif Yilmaz
  6. Evangelia Thanou
  7. Na Sun
  8. Ourania Kolliniati
  9. Maria Patschin
  10. Heba Abdelmegeed
  11. Holger Henneicke
  12. Waldemar Kanczkowski
  13. Ben Wielockx
  14. Christos Tsatsanis
  15. Andreas Dahl
  16. Axel Karl Walch
  17. Ka Wan Li
  18. Mirko Peitzsch
  19. Triantafyllos Chavakis
  20. Vasileia Ismini Alexaki
(2023)
Succinate mediates inflammation-induced adrenocortical dysfunction
eLife 12:e83064.
https://doi.org/10.7554/eLife.83064